|
Table Browser User's Guide
|
|
|
|
| |
The Table Browser provides a query interface to the Genome Browser
database tables.
Because the Table Browser uses the same database as the Genome Browser,
the two views are always consistent.
(Chromosomal coordinates usually change with each assembly because of
newly filled gaps or assembly procedure refinements.)
What can the Table Browser do?
The Table Browser can retrieve DNA sequence data or annotation data,
for Genome Browser tracks or for intersections/unions of tracks, over
a given position range, over a given set of accessions,
or over the whole genome.
It can display some basic statistics calculated over selected data.
It can generate a
custom track and
automatically add it to the user's session, so that it can be graphically
displayed in the Genome Browser. It allows
combined queries on two tables, or on a
user custom track and a table, so compound queries are possible.
One goal of the Table Browser is to provide an extremely flexible
query interface. The user can specify constraints on the values
of fields, to narrow down the set of results. The output format
is also highly configurable.
Some things that the Table Browser cannot do (yet) include
joining together relational tables in a unified interface.
The Table Browser is not as powerful as running MySQL on a
local installation of the database itself.
About the Genome Browser databases and tables
The
Genome Browser Database actually consists of several separate
databases, one for each genome assembly.
The Table Browser divides the tables in a database into two categories:
positional and non-positional.
Some output formats and query options are only applicable to positional
tables, thus the distinction.
- Positional tables contain data associated with specific locations
in the genome. mRNA alignments, gene predictions, cross-species
alignments, and other annotations are stored in positional tables.
Each Genome Browser track is based on a positional table (but may
incorporate information from non-positional tables).
- Non-positional tables contain data not tied to genomic locations.
For example, a table that relates a Genethon marker name to a
Marshfield marker name is non-positional.
Many tables relate internal numeric mRNA IDs to
information such as author, tissue, keyword, etc.
Some "meta" tables contain information about the structure of the
database itself or describe external files containing sequence data.
Positional tables can be further subdivided into several categories
based on the type of data they describe. Some tables
describe alignments, so they describe a block structure for each element.
Other tables do not describe a block structure (only a start and an end).
Some tables specify a translation start & end in addition to a
transcription start & end. Some tables specify the strand, some don't.
Most, but not all, give a name for each element. Based on what
a table describes, different query and output formatting options may be
offered.
Descriptions of the database tables are available
here.
| |
|
|
|
| |
The following sections describe the Table Browser pages with the
given titles.
Choose Organism & Assembly
This page prompts the user to select the organism (e.g. "Human") and
assembly (e.g. "Nov. 2002").
This is the gateway page for the Table Browser; it will appear when
the user clicks on the "Tables" link from the main page of the
genome server, or whenever the Table Browser is invoked without
specifying which genome assembly to use.
Choose a Table
This page is the entry point for the Table Browser when the genome
assembly has already been specified (for example, when the user
follows the "Tables" link from the Genome Browser).
There are four categories of tables:
- Browser tracks: Tables that correspond to Genome Browser tracks.
- Custom tracks:
User custom tracks in the current session.
- Positional tables: All positional tables,
whether or not they correspond to Genome Browser tracks, both from
the current assembly and from the hgFixed shared database.
- Non-positional tables: Tables without genomic coordinates, both
from the current assembly and from the hgFixed shared database.
In web browsers that support Javascript, whenever a selection is made from
one of the above menus, the other three menus are reset to avoid confusion.
In older web browsers without Javascript, it is possible to select tables
from multiple menus. In that case, the Table Browser will use the leftmost
selected table. Other selected tables will be ignored.
When a browser track, custom track or positional table is selected,
items can be selected from the table by position or by item name (which is
usually an accession for gene/mRNA/EST tracks). The default position
is "genome", which selects all items in the table. Any position or
search term accepted by the Genome Browser will also be accepted by the
Table Browser. If you have chosen to select items by name/accession,
then you must
paste or upload
a list of names/accessions before retrieving data.
When a non-positional table is selected, the position and any specified
names/accessions are ignored. All items in the table will be returned
by default. To restrict non-positional table items by name or accession,
paste values into the filter input for the appropriate field on the
Advanced Query page.
The "Get all fields" button simply retrieves
all elements from the table (at the specified position, if the table is
positional), and prints them out as
tab-separated plain text.
The "Get sequence" button works only when a browser track, custom track,
or positional table has been selected. It is for retrieving
FASTA sequence data for selected items.
The "Advanced Query" button leads to a richer choice of output formats and
filtering options, described
below.
The "Describe table" button displays
available information about the selected table.
Paste in Names/Accessions
Here the user can enter in a list of item names (usually accessions for
gene/mRNA/EST tracks), which may contain wildcard characters ("?" to match
exactly one character, "*" to match 0 or more characters).
Note: name/accession matching is not supported for non-positional
tables.
Upload a File of Names/Accessions
On this page, the user can upload a file containing item names
(usually accessions for gene/mRNA/EST tracks). Wildcards are not
allowed; the names must have exact matches in the table, or they will
be ignored.
Note: name/accession matching is not supported for non-positional
tables.
Describe Table
This page shows descriptive information about the currently selected
table and its fields. Buttons at the top and bottom of the page
offer the same choice of actions as the
Choose a Table page.
- AutoSql definition (if available): Many browser database tables
are generated and processed using SQL and C code generated by the tool
AutoSql. The AutoSql input format includes the name, data type
and descriptive comment for each field in a table and for the table itself.
It is often the best available documentation for a table.
- Link to table description (if available):
The
Genome Browser Database document is another source of information
about tables. Most database tables are described in corresponding
sections of the document.
Many sections contain just the autoSql definition, but some sections
contain more information about the format and other related tables.
- Field SQL types: Just in case the autoSql definition is outdated
(this can happen - please email
genome@cse.ucsc.edu
if you encounter this, thanks!)
or not available, we display the SQL field names and types
for the table as it truly exists in the current database.
For convenience, there are buttons which lead to histograms showing the
frequency of occurrences of values of text fields within the current
position range.
(The
Summary/Statistics output type, available via
Advanced Query, provides statistics about
integer values of position and exon/block fields.)
- Row count and first few rows: The total number of rows in the
table and the contents of the first few rows give an idea of
the data size and example values. No filtering or batch-querying is
reflected in the count, and the example rows will probably not be
from the current position (unless it is "genome"). They are shown
only as a descriptive example.
- Browser Track information (if available): If the table is the
main (positional) table for a Genome Browser track, then the data type,
track group name and HTML track description are shown.
Advanced Query
This page offers choices for
output format and
filtering of results
in several sections:
- Select Output Format for table
Output format choices for positional tables are
For non-positional tables, the choices are fewer:
- (Optional) Filter table Records by Field Values
This section allows the user to set
constraints
on the values of most table fields.
If no values are modified from the defaults, then no constraining or
filtering (other than position for positional tables) is done.
- (Optional) Intersect Results with Another Table
Here the user may select a second positional table and click the
"Intersect Results" button, which leads to the form described
below.
The Table Browser will remember the output format and filtering
constraints from above, and apply them after the "Intersect Results"
form is completed.
This section appears only when the primary table is positional,
because the
intersection/union
is performed on the positions contained in the selected tables.
For convenience, the "Get results" button (for non-intersected results)
appears in both the output format section and the filtering section.
It is the same button (same action),
offered in two places to save the user some scrolling.
Intersect Results
At this point the user has specified two positional tables, as well
as filtering constraints (if any) on the primary table. The output
format has also been selected -- for intersection of results, the
output format must be
FASTA,
BED/Custom Track,
Hyperlinks,
GTF, or
Summary/Statistics.
Now, the user may specify filtering constraints on the secondary table,
and must choose a mode for combining the results from each table:
- Specify how to combine tables table1 and table2
Here the user selects a
mode of combining
primary table results and secondary table results based on position.
The last two combinations (base-by-base positional intersection/union)
can be applied to the
base-by-base positional complement
of either or both tables.
- (Optional) Filter table2 Records by Field Values
This section allows the user to set
constraints
on the values of secondary table fields.
If no values are modified from the defaults, then no constraining or
filtering of the secondary table (other than position) is done.
BED/Custom Track Options
When the user has selected the BED/Custom Track format,
the Table Browser prompts for a few additional parameters:
- Include
custom track
header:
If this box is checked, then a custom track
"track" header line
will be generated with the name, description, visibility, and url fields.
Defaults are supplied, so the user does not have to enter any values.
- If the user has chosen to include a custom track header in the output,
then the user can also check
Load this custom track into my session
so that the results of the query will be locally stored (until 4 hours
after last usage). To view the custom track in the Genome Browser,
click the "Get BED" button and view (or save) the resulting BED data;
then click your web browser's "Back" button, then click
the "Genome Browser" link in the blue bar at the top of the page.
- Create one BED record per:
Here the user has the option to retrieve BED just for certain
components of each record, or from upstream/downstream of each record.
The options are different for each type of
table.
FASTA (DNA sequence) Options
This form prompts the user for additional parameters of
FASTA (DNA sequence) output:
- Sequence Retrieval Region Options:
If the table is a gene prediction or alignment table, i.e. specifying
exon, translation or block structure, then
the user can select which
subregions
of table records are
used to fetch DNA sequence. The user also has the choice to
concatenate the chunks of DNA sequence for each selected subregion
into one sequence, or to retrieve a separate sequence for each
selected subregion. (Concatenating is useful when all regions are
selected, or when exons are selected and introns are unselected
to see spliced mRNA sequence.)
- Sequence Formatting Options:
The user can select upper or lower case (for some subregions if
the table specifies structures), and can mask locations of
repetitive sequences (RepeatMasker) if desired.
Choose Fields
This form prompts the user to select which fields of the table to
include in
tab-separated output when the user has selected
the "Tab Separated, Choose Fields..." output format.
| |
|
|
|
| |
The Table Browser returns query results in one of the following formats.
Note: When querying
non-positional
tables, only the
Tab Separated and
Summary/Statistics formats are available.
BED/Custom Track
BED stands for Browser Extensible Data. It is a plain-text data format,
and is the internal representation used for all
user custom tracks
and for many Genome Browser tracks.
The BED format is described
here.
Selecting BED as the output data format allows the user to retain
their query results as user custom tracks, which can then be viewed
in the Genome Browser or queried again in the Table Browser to form
compound queries.
FASTA (DNA Sequence)
FASTA is a very simple plain text format for displaying nucleotide or
protein sequence.
(The Table Browser only outputs DNA sequence, not protein sequence,
at this time.)
For each record in FASTA output, there is one
header line which begins with ">" and contains a description of
the record, followed by one or more lines whose letters represent
the sequence.
Below is an example FASTA record returned by the Table Browser,
with an explanation of the header description fields. (The header
line is artificially broken into two lines for better display/printing
of this web page.)
>hg12_acembly_glutee_0 range=chr22:15586756-15586867 5'pad=0 3'pad=0 \
revComp=TRUE strand=- repeatMasking=none
GGCACTGACAGGACTTGACACATTCTAATCTCCTGAGGGCCGCTAACAAC
ATAGATGACAGTCTGGACAACACAAAGGGTCAACAGGTGCTCCGAGTGTC
CGGCAGGGCTAA
- hg12_acembly_glutee_0: The database is hg12
(Human June 2002),
the table is acembly,
the feature name is glutee,
and the user has selected to return a separate FASTA record for
each exon/intron on the
FASTA/DNA Sequence options form and
this is the first (_0) record (the first exon).
- range=chr22:15586756-15586867: The feature
extends from 15586756 to 15586867 on chr22. Note: the user may
choose to generate a single FASTA record for all exons, excluding
introns. In that case, the record may be shorter than the length
implied by the range.
- 5'pad=0 3'pad=0: The user has chosen to include no
extra bases at the 5' and 3' ends of each feature.
- revComp=TRUE strand=-: This feature is on the '-'
strand, so the sequence has been reverse complemented relative to
the genomic sequence at the given range.
- repeatMasking=none: The user has chosen not to mask
out (i.e. force to 'N' or lower-case) the bases that have been
identified as repeats by RepeatMasker.
GTF
GTF stands for Gene Transfer Format. It is also known as
GFF version 2. The spec can be found
here.
Hyperlinks to Genome Browser
For convenience, the Table Browser can generate links to the
Genome Browser at the location of each feature identified by
a query on a positional table.
Tab Separated
This plain text output format simply contains the contents of a table,
one table record per line,
with fields (columns) separated by tab characters.
The first line of output is a comment, starting with "#" and displaying
the field names separated by tab characters.
This format is easy to load into spreadsheets or process with scripts,
if the user wishes to perform additional analysis on a table.
Summary/Statistics
This format summarizes the user's query (including any
filtering constraints or
comparison of tables.
For
positional
tables, some statistics about the features are computed
(count, min/max/average/stdev of length, etc.) and displayed.
For all tables, the fields of the table and their SQL database types
are displayed. For text fields, the user may click to obtain a
frequency histogram of a field's values in the query results.
|
|
|
|
Filtering Results by Constraining Field Values
|
|
| |
By default, the table browser retrieves all records for the specified
coordinate range (use "genome" to search all chromosomes)
or set of item names/accessions.
To restrict the set of records retrieved from this range, you may
enter constraints on the values of fields.
The individual field constraints are combined with AND. In other
words, a record must meet all individual field constraints in order to
be retrieved. The default values will match all records, so the only
constraints that apply are the ones that you edit.
Constraints on strings
Text fields are compared to words or patterns containing wildcard
characters. Wildcards are "*" (to match 0 or more characters) and "?"
(to match a single character). Each space-separated word/pattern in a
text field box will be matched against the value of that field in each
record. If any word/pattern matches the value, then the record meets
the constraint on that field.
Constraints on numbers
Numeric fields are compared to table data using an operator such as <,
>, != (not equal) followed by a number. To specify a range, enter two
numbers (start and end) separated by whitespace and/or a comma (",").
Free-Form Query
When the filters above aren't enough, free-form queries allow
fancier constraints that typically relate two or more field names of
the selected table. If you are familiar with
SQL syntax,
queries here are just "where" clauses (with wildcards as above).
Queries can combine simple constraints with AND, OR, and NOT using
parentheses as needed for clarity.
A simple constraint consists of a field name listed above,
a comparison operator (see below),
and a value: a number, string, wildcard value (see below),
or another field name.
In place of a field name, you may use
an arithmetic expression of numeric field names.
String or wildcard values for text comparisons must be quoted.
Single or double quotes may be used.
If comparing to a literal string value,
you may use the "=" (or "!=") operator.
If comparing to a wildcard
value, you must use the "LIKE" (or "NOT LIKE") operator.
Numeric comparison operators include <, <=, =, != (not equal),
>=, and > .
Arithmetic operators include +, -, *, and /.
Other
SQL
comparison keywords may be used.
Free-form query examples (taken from the refGene table):
- txStart = cdsStart
searches for gene models missing expected 5' UTR upstream sequence
(if strand is '+'; 3' UTR downstream if strand is '-').
- chrom NOT LIKE "chr??"
filters search to chromosomes 1-9 plus X and Y.
- (cdsEnd - cdsStart) > 10000
selects genes whose coding regions span over 10 kbp.
- (txStart != cdsStart) AND (txEnd != cdsEnd)
AND exonCount = 1
finds single exon genes with both 3' and 5' flanking UTR.
- ((cdsEnd - cdsStart) > 30000)
AND (exonCount=2 OR exonCount=3)
finds genes with long spans but only 2-3 exons.
|
|
|
|
Filtering Results by Comparing Two Tables
|
|
| |
Sometimes it is interesting to see where the features of two
positional
tables do or do not cover the same positions in the genome.
The Table Browser offers several kinds of comparisons of tables
by feature positions.
Comparisons that preserve primary table structure
Some comparisons preserve the structure of the primary table.
In other words, if the primary table describes exon structure
and is filtered by one of these comparisons to any other table,
then the results will describe exon structure (unless the user
chooses an output format in which the structure is lost).
Primary table features are kept or discarded based on the
amount of positional overlap with secondary table features.
- Any overlap: A primary table record will appear in the output
if any of its base positions are also covered by
any feature in the secondary table.
- No overlap: A primary table record will appear in the output
only if none of its base positions are also covered by
any feature in the secondary table.
- Overlap over a specified threshold: A primary table record will
appear in the output
if the ratio of the number of its base positions covered by
secondary table features to the total number
of its base positions is greater than the user-specified threshold.
- Overlap under a specified threshold: A primary table record will
appear in the output
if the ratio of the number of its base positions covered by
secondary table features to the total number
of its base positions is less than the user-specified threshold.
Note: If the primary table has exon/block structure, then only
base positions in exons/blocks will be counted.
Base-by-base comparisons
The positions covered by features of the primary and secondary tables
can be compared one base position at a time, or base-by-base (as opposed
to feature-by-feature like above).
If the user selects one of the following comparisons, then the structure
of the primary table will not be preserved.
In other words, even if the primary table describes exon structure,
the results will not describe exon structure. Only position ranges
will be returned, with no information about exon/block structure,
strand, or translation region.
- Base-by-base intersection (AND): If a nucleotide position is
covered by at least one feature of both the primary table and the
secondary table, then it will be included in the output.
- Base-by-base union (OR): If a nucleotide position is
covered by at least one feature of either the primary table or the
secondary table, then it will be included in the output.
Note: If the primary table has exon/block structure, then only
base positions in exons/blocks will be counted.
Base-by-base complement (NOT): Before either of the above
comparisons are applied, the set of positions covered by a table
can be inverted. In other words, if this is selected, then any
position covered by the table's features will be considered
not covered, and vice versa. This gives the user more
flexibility in comparing table positions.
|
|
|
|
Retrieving Subregions of Features
|
|
| |
Subregions of gene predictions
A gene prediction table specifies both exon structure
and translated region. The choices of granularity are
- Whole Gene: the block structure and translated region
will be preserved in the BED data.
- Upstream by N bases: the BED data will contain
one simple (chrom/start/end/name) record per feature,
from the 5' end of the gene to N bases away.
If the strand is '+', the 5' end is the low coordinate
("start"). If the strand is '-', the 5' end is the
high coordinate ("end").
Block structure and translated region info will be lost.
- Exons plus N bases at each end: the BED data
will contain one simple record per exon, subtracting
N from the start and adding N to the end.
(N can be negative to make the region smaller
instead of larger.)
- Introns plus N bases at each end: the BED data
will contain one simple record per intron, subtracting
N from the start and adding N to the end.
(N can be negative to make the region smaller
instead of larger.)
- 5' UTR Exons: the BED data
will contain one simple record per 5' UTR exon.
Depending on the value of the strand, 5' may start at
the low coordinate "start" and proceed up (+), or it may
start at the high coordinate "end" and proceed down (-).
- Coding Exons: the BED data
will contain one simple record per coding exon.
(If the translated region boundaries fall in the middle
of exons, then the exons will be split at those boundaries.)
- 3' UTR Exons: the BED data
will contain one simple record per 3' UTR exon.
Depending on the value of the strand, 3' may start at
the high coordinate "end" and proceed down (+), or it may
start at the low coordinate "start" and proceed up (-);
- Downstream by N bases: the BED data will contain
one simple (chrom/start/end/name) record per feature,
from the 3' end of the gene to N bases away.
If the strand is '+', the 3' end is the high coordinate
("end"). If the strand is '-', the 3' end is the
low coordinate ("start").
Block structure and translated region info will be lost.
Note: if a feature is close to the beginning or end of a chromosome
and upstream/downstream bases are added, they may be truncated
in order to avoid extending past the edge of the chromosome.
Subregions of alignments
An alignment table specifies block structure, but not translated region.
- Whole Alignment: the block structure
will be preserved in the BED data.
- Upstream by N bases: the BED data will contain
one simple (chrom/start/end/name) record per feature,
from the 5' end of the alignment to N bases away.
If the strand is '+', the 5' end is the low coordinate
("start"). If the strand is '-', the 5' end is the
high coordinate ("end").
- Blocks plus N bases at each end: the BED data
will contain one simple record per block, subtracting
N from the start and adding N to the end.
(N can be negative to make the region smaller
instead of larger.)
- Regions between blocks plus N bases at each end:
the BED data
will contain one simple record per intron, subtracting
N from the start and adding N to the end.
(N can be negative to make the region smaller
instead of larger.)
- Downstream by N bases: the BED data will contain
one simple (chrom/start/end/name) record per feature,
from the 3' end of the gene to N bases away.
If the strand is '+', the 3' end is the high coordinate
("end"). If the strand is '-', the 3' end is the
low coordinate ("start").
Block structure and translated region info will be lost.
Note: if a feature is close to the beginning or end of a chromosome
and upstream/downstream bases are added, they may be truncated
in order to avoid extending past the edge of the chromosome.
Subregions of "thick/thin" records
A thick/thin table specifies a "thick" region in
the middle of each feature (surrounded by "thin" regions, as
displayed in the Genome Browser). The "thick" region usually
refers to translated region (but note that this type of table
does not specify block structure).
- Whole Gene: the "thick" (translated) region information
will be preserved in the BED data.
- Upstream by N bases: the BED data will contain
one simple (chrom/start/end/name) record per feature,
from the 5' end of the record to N bases away.
If the strand is '+', the 5' end is the low coordinate
("start"). If the strand is '-', the 5' end is the
high coordinate ("end").
- 5' UTR: the BED data
will contain one simple record per 5' UTR.
Depending on the value of the strand, 5' may start at
the low coordinate "start" and proceed up to the "thick"
region (+), or it may
start at the high coordinate "end" and proceed down (-) to
the "thick" region.
- CDS: the BED data
will contain one simple record (the "thick" region).
- 3' UTR: the BED data
will contain one simple record per 3' UTR.
Depending on the value of the strand, 3' may start at
the high coordinate "end" and proceed up to the "thick"
region (+), or it may
start at the low coordinate "start" and proceed down (-) to
the "thick" region.
- Downstream by N bases:
the BED data will contain
one simple (chrom/start/end/name) record per feature,
from the 3' end of the record to N bases away.
If the strand is '+', the 3' end is the high coordinate
("end"). If the strand is '-', the 3' end is the
low coordinate ("start").
Note: if a feature is close to the beginning or end of a chromosome
and upstream/downstream bases are added, they may be truncated
in order to avoid extending past the edge of the chromosome.
Subregions of simple records
A simple table specifies on the the start and end position (no
block structure or thick/thin region). However, upstream and
downstream regions are available. If a strand is specified,
then the meaning of upstream and downstream depend on the strand.
- Whole Gene: simple records (with strand and score, if
the table specifies strand and score) are output.
- Upstream by N bases: the BED data will contain
one simple (chrom/start/end/name) record per feature,
from the 5' end of the record to N bases away.
If the strand is '+', the 5' end is the low coordinate
("start"). If the strand is '-', the 5' end is the
high coordinate ("end").
- Downstream by N bases: the BED data will contain
one simple (chrom/start/end/name) record per feature,
from the 3' end of the record to N bases away.
If the strand is '+', the 3' end is the high coordinate
("end"). If the strand is '-', the 3' end is the
low coordinate ("start").
Note: if a feature is close to the beginning or end of a chromosome
and upstream/downstream bases are added, they may be truncated
in order to avoid extending past the edge of the chromosome.
|
|
|
|
Example Uses of the Table Browser
|
|
| |
All of these examples assume that the user has already selected a
genome assembly (for example, Human Nov. 2002).
Get DNA sequence for RefSeq genes
- If there is a particular gene of interest, enter the gene's
NM_?????? accession number
and click on the Look up button.
Otherwise, enter a position range, e.g. chr22:15500000-15750000
- Select refGene from the "Positional tables" menu.
Click on the Advanced query... button.
- Select FASTA (DNA Sequence) from the output format menu.
Click on the Get results button.
- Review the subregion and formatting options.
Click on the Get sequence button.
FASTA for all RefSeq genes in the position range will be displayed.
Get locations of all RefSeq genes that start with HOX
The refGene table contains the location of RefSeq genes, indexed by
accession number (NM_??????). The refFlat table contains the same
information, but indexed by gene name.
- To find all RefSeq genes that start with HOX in the whole genome,
change the position to genome.
- Select refFlat from the "Positional tables" menu.
Click on the Advanced query... button.
- Select Hyperlinks to the from the output format menu.
In the "Filter refFlat records" section,
enter HOX* in the box at the end of the line for the geneName field
('geneName [does] match ...').
Click on the Get results button.
A page of links into the Genome Browser at the location of each HOX*
gene will appear.
Get human alignments to mouse at ESPN
Note: This example assumes the existence of the blastzBestMouse track
in the current genome assembly/database, and the existence of the ESPN gene
in the current assembly's RefSeq Genes (refGene/refFlat) track. Before
starting this example, make sure the current database is set to Human,
June 2002 or later.
- Set position to ESPN and click the Look up button.
- Select chrN_blastzBestMouse from the "Positional tables" menu.
Click on the Get all fields button.
The contents of the chr1_blastzBestMouse table that fall at least partly
in the selected position range will be printed out as
tab-separated text.
The format used by the Genome Browser for tables containing alignments
(such as chrN_blastzBestMouse) is
PSL.
Get locations of repeats identified on exons of chr21 RefSeq genes
- Set position to chr21 and click the Look up button.
- Select chrN_rmsk from the "Positional tables" menu.
Click on the Advanced query... button.
- Select BED/Custom Track from the output format menu.
Scroll down to the "(Optional) Intersect Results" section.
Select refGene from the "Positional tables" menu.
Click the Intersect Results... button.
- Select All chrN_rmsk records that have any overlap with refGene
as the way to combine the tables.
Scroll down to the bottom of the page and click on the
BED/Custom Track button.
- Experiment with the BED options form by clicking the Get BED
button, looking at the results, then using your web browser's Back
button to return to the form and try other settings.
If you choose the Load this custom track into my session option
when experimenting with BED/Custom Track options, then the results will
be kept temporarily (until 8 hours after last usage) on the server.
To view your custom track, click your web browser's Back button,
then click the "Genome Browser" link on the blue bar near the top of
the page. Click the Submit button, and your Table Browser
generated custom track will appear at or near the top of the browser
tracks image.
Download the contents of a table for local processing
- Enter the position range (or gene name, accession, etc.) of
interest and click on the Look up button.
- Select a table from either the "Positional tables" menu or the
"Non-positional tables" menu.
Click the Get all fields button.
Please don't set the position to "genome" very often with this method
unless you are also filtering the results with
constraints on field values (or
comparison to another table).
The amount of data could be very large, could take a long time,
and could unnecessarily and unfairly load the server.
Instead, if you need to download the entire contents of tables,
see the
downloads page.
|
|
|
|