As vertebrate genome sequences near completion and research re-focuses on their analysis, the issue of effective sequence display becomes critical: it is not helpful to have 3 billion letters of genomic DNA shown as plain text! As an alternative, the UCSC Genome Browser provides a rapid and reliable display of any requested portion of genomes at any scale, together with dozens of aligned annotation tracks (known genes, predicted genes, ESTs, mRNAs, CpG islands, assembly gaps and coverage, chromosomal bands, mouse homologies, and more). Half of the annotation tracks are computed at UCSC from publicly available sequence data. The remaining tracks are provided by collaborators worldwide. Users can also add their own custom tracks to the browser for educational or research purposes.

The Genome Browser stacks annotation tracks beneath genome coordinate positions, allowing rapid visual correlation of different types of information. The user can look at a whole chromosome to get a feel for gene density, open a specific cytogenetic band to see a positionally mapped disease gene candidate, or zoom in to a particular gene to view its spliced ESTs and possible alternative splicing. The Genome Browser itself does not draw conclusions; rather, it collates all relevant information in one location, leaving the exploration and interpretation to the user.

The Genome Browser supports text and sequence based searches that provide quick, precise access to any region of specific interest. Secondary links from individual entries within annotation tracks lead to sequence details and supplementary off-site databases. To control information overload, tracks need not be displayed in full. Tracks can be hidden, collapsed into a condensed or single-line display, or filtered according to the user's criteria. Zooming and scrolling controls help to narrow or broaden the displayed chromosomal range to focus on the exact region of interest. Clicking on an individual item within a track opens a details page containing a summary of properties and links to off-site repositories such as PubMed, GenBank, Entrez, and OMIM. The page provides item-specific information on position, cytoband, strand, data source, and encoded protein, mRNA, genomic sequence and alignment, as appropriate to the nature of the track.

A blue navigation bar at the top of the browser provides links to several other tools and data sources. For instance, the DNA link enables the user to view the raw genomic DNA sequence for the coordinate range displayed in the browser window. This DNA can encode track features via elaborate text formatting options. Other links tie the Genome Browser to the BLAT alignment tool, provide access to the underlying relational database via the Table Browser, convert coordinates across different assembly dates, and open the window at the complementary Ensembl or NCBI Map Viewer annotation.

The browser data represents an immense collaborative effort involving thousands of people from the international biomedical research community. The UCSC Bioinformatics Group itself does no sequencing. Although it creates the majority of the annotation tracks in-house, the annotations are based on publicly available data contributed by many labs and research groups throughout the world. Several of the Genome Browser annotations are generated in collaboration with outside individuals or are contributed wholly by external research groups. UCSC's other major roles include building genome assemblies, creating the Genome Browser work environment, and serving it online. The majority of the sequence data, annotation tracks, and even software are in the public domain and are available for anyone to download.

In addition to the Genome Browser, the UCSC Genome Bioinformatics group provides several other tools for viewing and interpreting genome data:

• BLAT - a fast sequence-alignment tool similar to BLAST. Read more.
• Table Browser - convenient text-based access to the database underlying the Genome Browser. Read more.
• Gene Sorter - expression, homology, and other information on groups of genes that can be related in many ways. Read more.
• Proteome Browser (accessible from Known Genes details pages) - protein property data and links to a wealth of related information. Read more.

The UCSC Genome Bioinformatics home page provides access to Genome Browsers on several different genome assemblies. To get started, click the Browser link on the blue sidebar. This will take you to a Gateway page where you can select which genome to display.

Opening the Genome Browser at a specific position
To get oriented in using the Genome Browser, try viewing a gene or region of the genome with which you are already familiar, or use the default position. To open the Genome Browser window:

1.	Select the clade, genome and assembly that you wish to display from the corresponding pull-down menus. To access older assembly versions that are no longer available from the menu, look in the Genome Browser archives.
2.	Specify the genome location you'd like the Genome Browser to open to. To select a location, enter a valid position query in the position text box at the top of the Gateway page or accept the default position already displayed. The position search supports several different types of queries: gene symbols, mRNA or EST accession numbers, chromosome bands, descriptive terms likely to occur in GenBank text, or specific chromosomal ranges. To display a region encompassed by two features on the same chromosome, use a semi-colon, e.g. CRYBB3;CRYBB1. The Gateway page shows examples of some of the position requests supported by the Genome Browser.
3.	Click the submit button to open up the Genome Browser window to the requested location. In cases where a specific term (accession, gene name, etc.) was queried, the item will be highlighted in the display.

Occasionally the Gateway page returns a list of several matches in response to a position search, rather than immediately displaying the Genome Browser window. When this occurs, click on the item in which you're interested and the Genome Browser will open to that location.

The position search mechanism is not a site-wide search engine. Instead, it primarily searches GenBank mRNA records whose text annotations can include gene names, gene symbols, journal title words, author names, and RefSeq mRNAs. Searches on other selected identifiers, such as NP and NM accession numbers, OMIM identifiers, and Entrez Gene IDs are supported. However, some types of position queries will return an error, e.g. post-assembly GenBank entries, withdrawn gene names, and abandoned synonyms. If your initial position query is unsuccessful, try entering a different related term that may produce the same location. For example, if a query on a gene symbol produces no results, try entering an mRNA accession, gene ID number, or descriptive words associated with the gene.

Finding a genome location using BLAT
If you have genomic, mRNA, or protein sequence, but don't know the name or the location to which it maps in the genome, the BLAT tool will rapidly locate the position by homology alignment, provided that the region has been sequenced. This search will find close members of the gene family, as well as assembly duplication artifacts. An entire set of query sequences can be looked up simultaneously when provided in fasta format.

A successful BLAT search returns a list of one or more genome locations that match the input sequence. To view one of the alignments in the Genome Browser, click the browser link for the match. The details link can be used to preview the alignment to determine if it is of sufficient match quality to merit viewing in the Genome Browser. If too many BLAT hits occur, try narrowing the search by filtering the sequence in slow mode with RepeatMasker, then rerunning the BLAT search.

For more information on conducting and fine-tuning BLAT searches, refer to the BLAT section of this document.

Opening the Genome Browser with a custom annotation track
You can open the Genome Browser window with a custom annotation track displayed by using the Add Your Own Tracks feature, accessed from the Gateway page. For more information on creating and using custom annotation tracks, refer to the Custom Annotation Track documentation.

Annotation track data can be entered in one of three ways:

--	Enter the file name for an annotation track source file in the Annotation File text box.
--	Type or paste the annotation track data into the large text box.
--	If the annotation data is accessible through a URL, enter the URL name in the large text box.

Once you've entered the annotation information, click the submit button at the top of the Gateway page to open up the Genome Browser with the annotation track displayed.

The Genome Browser also provides a collection of custom annotation tracks contributed by the UCSC Genome Bioinformatics group and the research community.

NOTE: If an annotation track does not display correctly when you attempt to upload it, you may need to reset the Genome Browser to its default settings, then reload the track. For information on troubleshooting display problems with custom annotation tracks, refer to the section on Troubleshooting Annotation Display Problems.

Viewing genome data as text
The Table Browser, a portal to the underlying open source MySQL relational database driving the Genome Browser, displays genomic data as columns of text rather than as graphical tracks. For more information on using the Table Browser, see the section Getting Started: on the Table Browser.

Opening the Genome Browser from external gateways
Several external gateways provide direct links into the Genome Browser. Examples include: Entrez Gene, AceView, Ensembl, SuperFamily, GeneLynx, and GeneCards. Journal articles can also link to the browser and provide custom tracks. Be sure to use the assembly date appropriate to the provided coordinates when using data from a journal source.

Tips for Use
To facilitate your return to regions of interest within the Genome Browser, save the coordinate range or bookmark the page of displays that you plan to revisit or wish to share with others.

It is usually best to work with the most recent assembly even though a full set of tracks might not yet be ready. Be aware that the coordinates of a given feature on an unfinished chromosome may change from one assembly to the next as gaps are filled, artifactual duplications are reduced, and strand orientations are corrected. The Genome Browser offers multiple tools that can correctly convert coordinates between different assembly releases. For more information on conversion tools, see the section Converting data between assemblies.

To ensure uninterrupted browser services for your research during UCSC server maintenance and power outages, bookmark a mirror site that replicates the UCSC genome browser.

Bear in mind that the Genome Browser cannot outperform the underlying quality of the draft genome. Assembly errors and sequence gaps may still occur well into the sequencing process due to regions that are intrinsically difficult to sequence. Artifactual duplications arise as unavoidable compromises during a build, causing misleading matches in genome coordinates found by alignment.

The Genome Browser annotation tracks page displays a genome location specified through a Gateway position search, a BLAT search, or an uploaded custom annotation track. There are five main features on this page: a set of navigation controls, a chromosome ideogram, the annotations tracks image, display configuration buttons, and a set of track display controls.

The first time you open the Genome Browser, it will use the application default values to configure the annotation tracks display. By manipulating the navigation, configuration and display controls, you can customize the annotation tracks display to suit your needs. For a complete description of the annotation tracks available in all assembly versions supported by the Genome Browser, see the Annotation Track Descriptions section.

The Genome Browser retains user preferences from session to session within the same web browser, although it never monitors or records user activities or submitted data. To restore the default settings, click the "Click here to reset" link on the Genome Browser Gateway page. To return the display to the default set of tracks (but retain other configured Genome Browser settings), click the default tracks button on the Genome Browser page.

Display conventions
The annotation tracks displayed in the Genome Browser use a common set of display conventions:

--	Annotation track descriptions: Each annotation track has an associated description page that contains a discussion of the track, the methods used to create the annotation, the data sources and credits for the track, and (in some cases) filter and configuration options to fine-tune the information displayed in the track. To view the description page, click on the mini-button to the left of a displayed track or on the label for the track in the Track Controls section.
--	Annotation track details pages: When an annotation track is displayed in full, pack, or squish mode, each line item within the track has an associated details page that can be displayed by clicking on the item or its label. The information contained in the details page varies by annotation track, but may include basic position information about the item, related links to outside sites and databases, links to genomic alignments, or links to corresponding mRNA, genomic, and protein sequences.
--	Gene prediction tracks: Coding exons are represented by blocks connected by horizontal lines representing introns. The 5' and 3' untranslated regions (UTRs) are displayed as thinner blocks on the leading and trailing ends of the aligning regions. In full display mode, arrowheads on the connecting intron lines indicate the direction of transcription. In situations where no intron is visible (e.g. single-exon genes, extremely zoomed-in displays), the arrowheads are displayed on the exon block itself.
--	mRNA tracks: Aligning regions (usually exons) are shown as black blocks connected by lines representing gaps (usually spliced-out introns). In dense display mode, darker-shaded items correspond to better quality matches. In full display mode, arrowheads on the lines indicate the direction of transcription. In situations where no gap lines are visible, the arrowheads are displayed on the block itself. Only 300 track entries can be displayed in the annotation track window at a time in full display mode; the track automatically defaults to a denser display mode if the number exceeds this limit.
--	EST and BLAT alignment tracks: Aligning regions (usually exons) are shown as black blocks. In dense display mode, the degree of darkness corresponds to the number of features aligning to the region. In full display mode, the aligning regions are connected by lines representing gaps (usually spliced-out introns), with arrowheads indicating the direction of transcription. In situations where no gap lines are visible, the arrowheads are displayed on the block itself. Display limitations similar to the mRNA tracks apply to this track.
--	"Chain" tracks (2-species alignment): Chain tracks display boxes joined together by either single or double lines. The boxes represent aligning regions. Single lines indicate gaps that are largely due to a deletion in the genome of the first species or an insertion in the genome of the second species. Double lines represent more complex gaps that involve substantial sequence in both species. This may result from inversions, overlapping deletions, an abundance of local mutation, or an unsequenced gap in one species. In cases where there are multiple chains over a particular portion of the genome, chains with single-lined gaps are often due to processed pseudogenes, while chains with double-lined gaps are more often due to paralogs and unprocessed pseudogenes. In the fuller display modes, the individual feature names indicate the chromosome, strand, and location (in thousands) of the match for each matching alignment.
--	"Net" tracks (2-species alignment): Boxes represent ungapped alignments, while lines represent gaps. Clicking on a box displays detailed information about the chain as a whole, while clicking on a line shows information on the gap. The detailed information is useful in determining the cause of the gap or, for lower level chains, the genomic rearrangement. Individual items in the display are categorized as one of four types (other than gap): Top - The best, longest match. Displayed on level 1. Syn - Lineups on the same chromosome as the gap in the level above it. Inv - A lineup on the same chromosome as the gap above it, but in the opposite orientation. NonSyn - A match to a chromosome different from the gap in the level above.
--	Cross-species synteny and orthology tracks: Sequences from an organism that match regions of the displayed genome are represented by blocks of various colors. The block color indicates the chromosomal location of the sequence in the organism's genome, as shown by the Chromosome Color Key below the annotation track window.
--	"Wiggle" tracks (Cross-species conservation): These tracks plot a continuous function along a chromosome. Data is displayed in windows of a set number of base pairs in width. The score for each window is given on a logarithmic scale, which displays as "mountain ranges". The display characteristics vary among the tracks in this group. See the individual track descriptions for more information on interpreting the display.

Changing the display mode of an individual annotation track
Each annotation track within the window may have up to five display modes:

--	Hide: the track is not displayed at all. To hide all the annotation tracks, click the hide all button. This mode is useful for restricting the display to only those tracks in which you are interested. For example, someone who is not interested in SNPs or mouse synteny may want to hide these tracks to reduce track clutter and improve speed. There are a few annotation tracks that pertain only to one specific chromosome, e.g. Sanger22, Rosetta. In these cases, the track and its associated controller will be hidden automatically when the track window is not open to the relevant chromosome.
--	Dense: the track is displayed with all features collapsed into a single line. This mode is useful for reducing the amount of space used by a track when you don't need individual line item details or when you just want to get an overall view of an annotation. For example, by opening an entire chromosome and setting the RefSeq Genes track to dense, you can get a feel for the known gene density of the chromosome without displaying excessive detail.
--	Full: the track is displayed with each annotation feature on a separate line. It is recommended that you use this option sparingly, due to the large number of individual track items that may potentially align at the selected position. For example, hundreds of ESTs might align with a specified gene. When the number of lines within a requested track location exceeds 250, the track automatically defaults to a more tightly-packed display mode. In this situation, you can restore the track display to full mode by narrowing the chromosomal range displayed or by using a track filter to reduce the number of items displayed. On tracks that contain only hide, dense, and full modes, you can toggle between full and dense display modes by clicking on the track's center label.
--	Squish: the track is displayed with each annotation feature shown separately, but at 50% the height of full mode. Features are unlabeled, and more than one may be drawn on the same line. This mode is useful for reducing the amount of space used by a track when you want to view a large number of individual features and get an overall view of an annotation. It is particularly good for displaying tracks in which a large number of features align to a particular section of a chromosome, e.g. EST tracks.
--	Pack: the track is displayed with each annotation feature shown separately and labeled, but not necessarily displayed on a separate line. This mode is useful for reducing the amount of space used by a track when you want to view the large number of individual features allowed by squish mode, but need the labeling and display size provided by full mode. When the number of lines within the requested track location exceeds 250, the track automatically defaults to squish display mode. In this situation, you can restore the track display to pack mode by narrowing the chromosomal range displayed or by using a track filter to reduce the number of items displayed. To toggle between pack and full display modes, click on the track's center label.

The track display controls are grouped into categories that reflect the type of data in the track, e.g. Gene Prediction Tracks, mRNA and EST tracks, etc. To change the display mode for a track, find the track's controller in the Track Controls section at the bottom of the Genome Browser page, select the desired mode from the control's display menu, and then click the refresh button. Alternatively, you can toggle between dense and full modes for a displayed track (or pack mode when available) by clicking on the optional center label for the track.

Changing the display mode for a group of tracks
Track display modes may be set individually or as a group on the Genome Browser Track Configuration page. To access the configuration page, click the configure button on the annotation tracks page or the configure tracks and display button on the Gateway page. Exercise caution when using the show all buttons on track groups or assemblies that contain a large number tracks; this may seriously impact the display performance of the Genome Browser or cause your Internet browser to time out.

Hiding the track display controls
The entire set of track display controls at the bottom of the annotation tracks page may be hidden from view by checking the Show track controls under main graphic option in the Configure Image section of the Track Configuration page.

Changing the display of a track by using filters and configuration options
Some tracks have additional filter and configuration capabilities, e.g. EST tracks, mRNA tracks, NC160, etc. These options let the user modify the color or restrict the data displayed within an annotation track. Filters are useful for focusing attention on items relevant to the current task in tracks that contain large amounts of data. For example, to highlight ESTs expressed in the liver, set the EST track filter to display items in a different color when the associated tissue keyword is "liver". Configuration options let the user adjust the display to best show the data of interest. For example, the min vertical viewing range value on wiggle tracks can be used to establish a data threshold. By setting the min value to "50", only data values greater than 50 percent will display.

To access filter and configuration options for a specific annotation track, open the tracks' description page by clicking the label for the track's control menu under the Track Controls section or the mini-button to the left of the displayed track. The filter and configration section is located at the top of the description page. In most instance, more information about the configuration options is available within the description text or through a special help link located in the configuration section.

Filter and configuration settings are persistent from session to session on the same web browser. To return the Genome Browser display to the default set of tracks (but retain other configured Genome Browser settings), click the default tracks button on the Genome Browser tracks page. To remove all user configuration settings and completely restore the defaults, click the "Click here to reset" link on the Genome Browser Gateway page.

Zooming and scrolling the tracks display
At times you may want to adjust the amount of flanking region displayed in the annotation tracks window or adjust the scale of the display. At a scale of 1 pixel per base pair, the window accurately displays the width of exons and introns, and indicates the direction of transcription (using arrowheads) for multi-exon features. At a grosser scale, certain features - such as thin exons - may disappear. Also, some exons may falsely appear to fall within RepeatMasker features at some scales.

Click the zoom in and zoom out buttons at the top of the Genome Browser page to zoom in or out on the center of the annotation tracks window by 1.5, 3 or 10-fold. Alternatively, you can zoom in 3-fold on the display by clicking anywhere on the Base Position track. In this case, the zoom is centered on the coordinate of the mouse click. To view the base composition of the sequence underlying the current annotation track display, click the base button.

To scroll the annotation tracks sideways to the left or right by 10%, 50%, or 95% of the displayed size (as given in base pairs), click the corresponding move arrow. It is also possible to scroll the left or right side of the tracks by a specified number of vertical gridlines while keeping the position of the opposite side fixed. To do this, click the appropriate move start or move end arrow, located under the annotation tracks window. For example, to keep the left-hand display coordinate fixed but increase the right-hand coordinate, you would click the right-hand move end arrow. To increase or decrease the gridline scroll interval, edit the value in the move start or move end text box.

Changing the displayed track position
To display a completely different position in the genome, enter the new position query in the position text box, then click the jump button. For more information on valid entries for this text box, refer to the Getting Started section.

Changing the width of the annotation track window
By default, the width of the annotation track window is set to 610 pixels. To modify the width to best suit the display capabilities of your monitor, enter a new value in the image width text box on the Track Configuration page, then click the submit button. For example, setting the display to 1100 pixels on a 19" monitor will increase the visible portion of the genome and reduce the need for redraws. The maximum supported width is 5000 pixels.

Changing the text size in the annotation track image
The annotation track image may be adjusted to display text in a range of fonts from "tiny" to "huge". To change the size of the text, select an option from the text size pull-down menu on the Track Configuration page, then click Submit. The text size is set to "small" by default.

Hiding the annotation track labels
The track and element labels displayed above and to the left of the tracks in the annotation tracks image may be hidden from view by unchecking the Display track descriptions above each track and Display labels to the left of items in tracks boxes, respectively, on the Track Configuration page.

Hiding the display grid on the annotation tracks image
The light blue vertical guidelines on the annotation tracks image may be removed by unchecking the Show light blue vertical guidelines box on the Track Configuration page.

Hiding the chromosome ideogram
The chromosome ideogram, located just above the annotation tracks image, provides a graphical overview of the features on the selected chromosome, including its bands, the position of the centromere, and an indication of the region currently displayed in the annotation tracks image. To hide the ideogram, uncheck the Display chromosome ideogram above main graphic box on the Tracks Configuraiton page.

Printing a copy of the annotation track window
The Genome Browser provides a mechanism for saving a copy of the currently displayed annotation tracks image to a file that can be printed or edited. Images saved in PostScript format can be printed at high resolution and edited by drawing programs such as Adobe Illustrator. This is useful for generating figures intended for publication. Images can also be saved in PDF format for viewing by Adobe Acrobat Reader.

To print or save the image to a file:

1.	Click the PDF/PS link in the menu on the annotation tracks page.
2.	Click the PostScript or PDF link.

On DNA queries, BLAT is designed to quickly find sequences with 95% or greater similarity of length 40 bases or more. It may miss genomic alignments that are more divergent or shorter than these minimums, although it will find perfect sequence matches of 33 bases and sometimes as few as 22 bases. The tool is capable of aligning sequences that contain large introns. On protein queries, BLAT rapidly locates genomic sequences with 80% or greater similarity of length 20 amino acids or more. In general, gene family members that arose within the last 350 million years can generally be detected. More divergent sequences can be aligned to the human genome by using NCBI's BLAST and psi-BLAST, then using BLAT to align the resulting match onto the UCSC genome assembly. In practice DNA BLAT works well on primates, and protein BLAT works well on land vertebrates.

Some common uses of BLAT include:

--	finding the genomic coordinates of mRNA or protein within a given assembly
--	determining the exon structure of a gene
--	displaying a coding region within a full-length gene
--	isolating an EST of special interest as its own track
--	searching for gene family members
--	finding human homologs of a query from another species.

Making a BLAT query
To locate a nucleotide or protein within a genome using BLAT:

1.	Open the BLAT Search Genome page by clicking the BLAT link on the top blue menu bar of any of the Genome Browser pages.
2.	Select the genome, assembly, query type, output sort order, and output type. To order the search results based on the closeness of the sequence match, choose one of the score options in the Sort output menu. The score is determined by the number of matches vs. mismatches in the final alignment of the query to the genome.
3.	If the sequence to be uploaded is in an unformatted plain text file, enter the file name in the Upload sequence text box, then click the submit file button. Otherwise, paste the sequence or fasta-formatted list into the large edit box, and then click the submit button. Input sequence can be obtained from the Genome Browser as well as from a custom annotation track.

Header lines may be included in the input text if they are preceded by > and contain unique names. Multiple sequences may be submitted at the same time if they are of the same type and are preceded by unique header lines. Numbers, spaces, and extraneous characters are ignored:

>sequence_1
ATGCAGAGCAAGGTGCTGCTGGCCGTCGCCCTGTGGCTCTGCGTGGAGAC
CCGGGCCGCCTCTGTGGGTTTGCCTAGTGTTTCTCTTGATCTGCCCAGGC
>sequence_2
ATGTTGTTTACCGTAAGCTGTAGTAAAATGAGCTCGATTGTTGACAGAGA
TGACAGTAGTATTTTTGATGGGTTGGTGGAAGAAGATGACAAGGACAAAG
>sequence_3
ATGCTGCGAACAGAGAGCTGCCGCCCCAGGTCGCCCGCCGGACAGGTGGC
CGCGGCGTCCCCGCTCCTGCTGCTGCTGCTGCTGCTCGCCTGGTGCGCGG

BLAT limitations
DNA input sequences are limited to a maximum length of 25,000 bases. Protein or translated input sequences must not exceed 5000 letters. As many as 25 multiple sequences may be submitted at the same time. The maximum combined length of DNA input for multiple sequence submissions is 50,000 bases (with a 25,000 base limit per individual sequence). For protein or translated input, the maximum combined input length is 12,500 letters (with a 5000 letter limit per individual sequence).

NOTE: Program-driven BLAT use is limited to a maximum of one hit every 15 seconds and no more than 5000 hits per day.

BLAT query search results
If a query returns successfully, BLAT will display a flat database file that summarizes the alignments found. A BLAT query often generates multiple hits. This can happen when the genome contains multiple copies of a sequence, paralogs, pseudogenes, statistical coincidences, artifactual assembly duplications, or when the query itself contains repeats or common retrotransposons. When too many hits occur, try resubmitting the query sequence after filtering in slow mode with RepeatMasker.

Items in the search results list are ordered by the criteria specified in the Sort output menu. Each line item provides links to view the details of the sequence alignment or to open the corresponding view in the Genome Browser. The details link gives the letter-by-letter alignment of the sequence to the genome. It is recommended that you first examine the details of the alignment for match quality before viewing the sequence in the Genome Browser.

When several nearby BLAT matches occur on a single chromosome, a simple trick can be used to quickly adjust the Genome Browser track window to display all of them: open the Genome Browser with the match that has the lowest chromosome start coordinate, paste in the highest chromosome end coordinate from the list of matches, then click the jump button.

Creating a custom annotation track from BLAT output
To make a custom track directly from BLAT, select the PSL format output option. The resulting PSL track can be uploaded into the Genome Browser by pasting it into the Add Your Own Tracks text box, accessed from the Browser Gateway page.

Using BLAT for large batch jobs or commercial use
For large batch jobs or internal parameter changes, it is best to install command line BLAT on your own Linux server. Sources and executables are free for academic, personal, and non-profit purposes. BLAT source may be downloaded from http://www.soe.ucsc.edu/~kent (look for the blatSrc*.zip file with the most recent date). For BLAT executables, go to http://www.soe.ucsc.edu/~kent/exe/; binaries are sorted by platform. Non-exclusive commercial licenses are available from the Genome BLAT website.

BLAT documentation
For more information on the BLAT suite of programs, see the BLAT Program Specifications and the Blat section of the Genome Browser FAQ.

The Table Browser provides text-based access to the genome assemblies and annotation data stored in the Genome Browser database. As a flexible alternative to the graphical-based Genome Browser, this tool offers an enhanced level of query support that includes restrictions based on field values, free-form SQL queries, and combined queries on multiple tables. Output can be filtered to restrict the fields and lines returned, and may be organized into one of several formats, including a simple tab-delimited file that can be loaded into a spreadsheet or database as well as advanced formats that may be uploaded into the Genome Browser as custom annotation tracks. The Table Browser provides a convenient alternative to downloading and manipulating the entire genome and its massive data tracks. (See the Downloading Genome Data section.)

For information on using the Table Browser features, refer to the Table Browser User Guide.

The Genome Browser provides a feature to configure the retrieval, formatting, and coloring of the text used to depict the DNA sequence underlying the features in the displayed annotation tracks window. Retrieval options allow the user to add a padding of extra bases to the upstream or downstream end of the sequence. Formatting options range from simply displaying exons in upper case to elaborately marking up a sequence according to multiple track data. The DNA sequence covered by various tracks can be highlighted by case, underlining, bold or italic fonts, and color.

The DNA display configuration feature can be useful to highlight features within a genomic sequence, point out overlaps between two types of features (for example, known genes vs. gene predictions), or mask out unwanted features.

Using the DNA text formatting feature
To access the feature, click on the DNA link on the top blue menu bar on the Genome Browser page. The Get DNA in Window page that appears contains sections for configuring the retrieval and output format.

To display extra bases upstream of the 5' end of your sequence or downstream of the 3' end of the sequence, enter the number of bases in the corresponding text box. This option is useful in looking for regulatory regions.

The Sequence Formatting section lists several options for adjusting the case of all or part of the DNA sequence. To choose one of these formats, click the corresponding option button, then click the get DNA button. To access a table of extended formatting options, click the Extended case/color options button.

The Extended DNA Case/Color page presents a table with many more format options. The page provides instructions for using the formatting table, as well as examples of its use. The list of tracks in the Track Name column is automatically generated from the list of tracks available on the current genome.

Tips for Use
A few caveats mentioned on the Extended DNA Case/Color page bear repeating. Keep the formatting simple at first: it is easy to make a display that is pretty to look at but is also completely cryptic. Also, be careful when requesting complex formatting for a large chromosomal region: when all the HTML tags have been added to the output page, the file size may exceed the size limits that your internet browser, clipboard, and other software can safely display. The maximum size of genome that can be formatted by the tool is approximately 10 Mbp.

Coordinates of features frequently change from one assembly to the next as gaps are closed, strand orientations are corrected, and duplications are reduced. Occasionally, a chunk of sequence may be moved to an entirely different chromosome as the map is refined. There are 3 different methods available for migrating data from one assembly to another: BLAT alignment, coordinate conversion, and lifting of coordinates. The BLAT alignment tool is described in the section Using BLAT alignments.

Coordinate conversion
The Genome Browser Convert tool is useful for locating the position of a feature of interest in a newer release of a genome. During the conversion process, portions of the genome in the coordinate range of the original assembly are aligned to the new assembly while preserving their order and orientation. In general, it is easier to achieve successful conversions with shorter sequences. NOTE: At the present time, this tool may be used only on human genome assemblies.

The conversion tool works by performing a BLAT search on the first 1000, last 1000, and middle 1000 bases in the current window. If all three searches land uniquely in the same order on the other version, the program announces a successful conversion. If the search results are not so straightforward, the user is given various options to find the corresponding sequence. Frequently, if the feature the user is looking for is tied to an mRNA, it is simplest just to BLAT the mRNA.

Using the convert tool
To access the conversion tool, click the Convert link in the top menu bar on the Genome Browser page. On the page that displays, select the assembly version in which the feature is located in the Original Draft list, then pick the assembly version you'd like to convert to in the New Draft list. Modify the position coordinates if necessary, then click the submit button. Note that archived assembly versions are not accessible from the conversion tool. Currently the tool supports only the human genome.

If the match is successful, the Genome Browser will announce success and display the coordinate ranges for both the original and new assemblies. Clicking the browser link to the right of the coordinate range will start up the browser at the given position on the assembly. The Alignment Details section shows which sequences of the original draft were aligned by BLAT to determine the new set of coordinates. Note that the conversion is a best guess: it is recommended that you check with local landmarks and use common sense when evaluating the results.

If the conversion is unsuccessful, the Genome Browser returns a failure message and a possible explanation for the failure.

Lifting coordinates
The liftOver tool is useful for converting a large number of coordinates to a different assembly. This command-line utility requires access to a Linux platform. The executable file can be downloaded from www.soe.ucsc.edu/~kent/exe/linux/liftOver.gz. LiftOver requires a UCSC-generated over.chain file as input. Pre-generated files for a given assembly are located in the liftOver subdirectory of the assembly's downloads directory. If the desired conversion file is not available, one can be obtained by sending a request to the genome mailing list.

Most of the underlying tables containing the genomic sequence and annotation data displayed in the Genome Browser can be downloaded. All of the tables are freely usable for any purpose except as indicated in the README.txt file in the download directories. This data was contributed by many researchers, as listed on the Genome Browser Credits page. Please acknowledge the contributor(s) of the data you use.

Downloading the data
Genome data can be downloaded in two different ways:

--

Via ftp:The UCSC Genome Bioinformatics ftp site contains download directories for all genome versions currently accessible in the Genome Browser. The ftp command ftp://hgdownload.cse.ucsc.edu/goldenPath/ will take you to a directory that contains the genome download directories. This download method is recommended if you plan to download a large file or multiple files from a single directory. Use the mget command to download multiple files: mget filename1 filename2, or mget -a (to download all the files in the directory).

--

Via the Downloads link: Click the Downloads link on the left side bar on the UCSC Genome Bioinformatics home page to display a list of all database directories available for download. If the data you wish to download pre-dates the assembly versions listed, look in the archives accessible from the Archive link on the home page.

Types of data available
There may be several download directories associated with each version of a genome assembly: the full data set (bigZips), the full data set by chromosome (chromosome), the annotation database tables (database), and one or more sets of comparative cross-species alignments.

BigZips contains the entire draft of the genome in chromosome and/or contig form. Depending on the genome, this directory may contain some or all of the following files:

--	chromAgp.zip: Description of how the assembly was generated, unpacking to one file per chromosome.
--	chromFa.zip: The assembly sequence chromosomes, in one file per chromosome. Repeats from RepeatMasker and Tandem Repeats Finder are shown in lower case; non-repeating sequence is in upper case. The main assembly is contained in the chrN.fa files, where chrN is the name of the chromosome. The chrN_random.fa files contain clones that are not yet finished or cannot be placed with certainty at a specific place on the chromosome. In some cases, including the human HLA region on chromosome 6, the chrN_random.fa files also contain haplotypes that differ from the main assembly.
--	chromFaMasked.zip: The assembly sequence chromosomes, in one file per chromosome. Repeats are masked by capital Ns; non-repeating sequence is shown in upper case.
--	chromOut.zip: RepeatMasker .out file for chromosomes, generated by RepeatMasker at the -s sensitive setting.
--	chromTrf.zip: Tandem Repeats Finder locations, filtered to keep repeats with period less than or equal to 12, translated into one .bed file per chromosome.
--	contigAgp.zip: Description of how the assembly was generated from fragments at a contig layout level.
--	contigFa.zip: The assembly sequence contigs, in one file per contig. All contigs are in forward orientation relative to the chromosome. In some cases, this means that contigs will be reversed relative to their orientation in the NCBI assembly. Repeats are shown in lower case; non-repeating sequence is shown in upper case.
--	contigFaMasked.zip: The assembly sequence contigs, in one file per contig. Repeats are masked by capital Ns; non-repeating sequence is shown in upper case.
--	contigOut.zip: RepeatMasker .out file for contigs, generated by RepeatMasker at the -s sensitive setting.
--	contigTrf.zip: Tandem Repeats Finder locations, filtered to keep repeats with period less than or equal to 12, and translated into one .bed file per contig.
--	database.zip: The Genome Browser database as tab-delimited files and associated MySQL table-creation tiles (eliminated in later assemblies due to size restrictions).
--	est.fa.zip: Sequences of all GenBank ESTs for the selected species.
--	liftAll.zip: The offsets of contigs within chromosomes.
--	mrna.zip: mRNAs in GenBank from the selected species.
--	refmrna.zip: RefSeq mRNAs from the selected species.
--	upstream1000.zip: Sequences 1000 bases upstream of annotated transcription start of RefSeq genes. This includes only cases where the transcription start is annotated separately from the coding region start.
--	upstream2000.zip: Same as upstream1000, but with 2000 bases.
--	upstream5000.zip: Same as upstream1000, but with 5000 bases.
--	xenoMrna.zip: All GenBank mRNAs from species other than that of the selected one.

Chromosomes contains the assembled sequence for the genome in separate files for each chromosome in a zipped fasta format. The main assembly can be found in the chrN.fa files, where N is the name of the chromosome. The chrN_random.fa files contain clones that are not yet finished or cannot be placed with certainty at a specific place on the chromosome. In some cases, the chrN_random.fa files also contain haplotypes that differ from the main assembly.

Database contains all of the positional and non-positional tables in the genome annotation database. Each table is represented by 2 files:

--	.sql file: the MySQL commands used to create the table.
--	.txt.gz file: the MySQL database table data in tab-delimited format and compressed with gzip.

The Description of the annotation database link on the Downloads page points to a document containing a full description of all the tables in the annotation database.

Cross-species alignments directories, such as the vsMm4 and humorMm3Rn3 directories in the hg16 assembly, contain pairwise and multiple species alignments and filtered alignment files used to produce cross-species annotations. For more information, refer to the READMEs in these directories and the description of the Multiple Alignment Format (MAF).

The Genome Browser provides dozens of aligned annotation tracks that have been computed at UCSC or have been provided by outside collaborators. In addition to these standard tracks, it is also possible for users to upload their own annotations for temporary display in the browser. These custom annotation tracks are viewable only on the machine from which they were uploaded and are only kept for 8 hours after the last time they were accessed. Optionally, users can make custom annotations viewable by others as well.

Custom tracks are an important research feature of the Genome Browser. Because space is limited in the Genome Browser track window, many excellent genome-wide tracks cannot be included in the set of tracks packaged with the Genome Browser. Other tracks of interest may be excluded from distribution because the annotation track data is too specific to be of general interest or can't be shared until journal publication. To view a list of custom annotation tracks submitted by Genome Browser users, click the Custom Tracks link on the Genome Browser home page.

Custom annotation tracks are similar to standard tracks, but never become part of the MySQL genome database. Each track has its own controller and persists even when not displayed in the Genome Browser window, e.g. if the position changes to a range that no longer includes the track. Typically, custom annotation tracks are aligned under corresponding genomic sequence, but they can also be completely unrelated to the data. For example, a track can be displayed under a long sequence consisting of millions of Ns.

This section presents a summary of the steps involved in constructing and displaying a custom annotation track. For a complete discussion of custom annotation tracks, file formats, custom URLs, and a troubleshooting guide, refer to the document Displaying Your Own Annotations in the Genome Browser.

Creating a custom annotation track
Genome Browser annotation tracks are based on files in line-oriented format. Each line in the file defines a display characteristic for the annotation track or defines a data item within the track. Annotation files contain 3 types of lines: browser lines, track lines, and data lines. Empty lines and lines starting with # in the annotation file are ignored.

The easiest way to create a correctly formatted annotation track is by collecting PSL output from BLAT. Advanced users can make custom tracks from the Table Browser and track-formatted DNA. To create a custom annotation track from scratch, it's best to begin with the examples and experiment with new lines and altered values in a spreadsheet or text editor.

To construct an annotation file and display it in the Genome Browser, follow these steps:

Step 1. Format the data set
Formulate your data set as a tab-separated file using one of the formats supported by the Genome Browser. Annotation data can be in standard GFF format or in a format designed specifically for the Human Genome Project, including GTF, PSL, or BED. GFF and GTF files must be tab-delimited rather than space-delimited to display correctly. You may include more than one data set in your annotation file. However, all of the data lines for a given annotation track must be in the same format.

Step 2. Define the Genome Browser display characteristics
Add one or more optional browser lines to the beginning of your formatted data file to configure the overall display of the Genome Browser when it initially displays your annotation data. Browser lines allow you to configure such things as the genome position that the browser will initially open to, the width of the display, and the configuration of the other annotation tracks that are shown (or hidden) in the initial display. NOTE: If the browser position is not explicitly set in the annotation file, the initial display will default to the position setting most recently used by the user, which may not be an appropriate position for viewing the annotation track.

Step 3. Define the annotation track display characteristics
Following the browser lines - and immediately preceding the formatted data - add a track line to define the display attributes for your annotation data set. Track lines allow you to define annotation track characteristics such as the name, description, colors, initial display mode, use score, etc. If you have included more than one data set in your annotation file, insert a track line at the beginning of each new set of data.

Example:
Here is an example of an annotation file that defines 2 separate annotation tracks in BED format. The first track displays blue one-base tick marks every 10000 bases at the beginning of chr 22. The second track displays red 100-base features alternating with blank space in the same region of chr 22.

browser position chr22:1-20001
track name=spacer description="My blue ticks" color=0,0,255
chr22   0        1
chr22   10000 10001
chr22   20000 20001
track name=even description="My red 100 bases tracks" color=255,0,0
chr22   0       100 first
chr22   200     300 second
chr22   400     500 third

Example:
This example shows an annotation file containing one data set in BED format. The track displays paired features with a thick end and thin end, and hatch marks indicating the direction of transcription. The track labels display in green (0,128,0), and the gray level of the each feature reflects the score value of that line. NOTE: The track line in this example has been split over 2 lines for documentation purposes. If you paste this example into the browser, you must remove the line break to display the track successfully.

browser position chr22:1000-10000
browser hide all
track name=pairedReads description="Clone Paired Reads" visibility=2
color=0,128,0 useScore=1
chr22 1000 5000 cloneA 960 + 1000 5000 0 2 567,488, 0,4512
chr22 2000 6000 cloneB 200 - 2000 6000 0 2 433,399, 0,5601

Step 4. View your annotation track in the Genome Browser
To view your annotation data in the Genome Browser, open up the UCSC Genome Bioinformatics home page (http://genome.ucsc.edu/) and click on the Genome Browser link in the top menu bar. On the Genome Browser Gateway page that displays, select the genome and assembly on which your annotation data is based, then click the add your own tracks button. Upload your annotation file by entering the name of your file in the Annotation File box or by pasting the contents of your file into the large edit box. Scroll back to the top of the page and click the submit button to display the Genome Browser track window with your annotation. If you encounter difficulties in displaying your annotation, read the section Troubleshooting Annotation Display Problems.

To upload a custom annotation track from another machine or web site, paste the URL of the track into the large edit box. Custom tracks can be displayed in conjunction with ordinary BLAT tracks.

Step 5. (Optional) Add details pages for individual track features
After you've constructed your track and have successfully displayed it in the Genome Browser, you may wish to customize the details pages for individual track features. The Genome Browser automatically creates a default details page for each feature in the track containing the feature's name, position information, and a link to the corresponding DNA sequence. To view the details page for a feature in your custom annotation track (in full display mode), click on the item's label in the annotation track window.

You can add a link from a details page to an external web page containing additional information about the feature by using the track line url attribute. In the annotation file, set the url attribute in the track line to point to a publicly available page on a web server. The url attribute substitutes each occurrence of '$$' in the URL string with the name defined by the name attribute. You can take advantage of this feature to provide individualized information for each feature in your track by creating HTML anchors that correspond to the feature names in your web page.

Example:
Here is an example of a file in which the url attribute has been set to point to the file http://genome.ucsc.edu/goldenPath/help/clones.html. The '#$$' appended to the end of the file name in the example points to the HTML NAME tag within the file that matches the name of the feature (cloneA, cloneB, etc.). NOTE: The track line in this example has been split over 3 lines for display purposes. If you paste this example into the browser, you must remove the line breaks to display the track successfully.

browser position chr22:1000-10000
browser hide all
track name=clones description="Clones" visibility=2
color=0,128,0 useScore=1 
url="http://genome.ucsc.edu/goldenPath/help/clones.html#$$"
chr22 1000 5000 cloneA 960 
chr22 2000 6000 cloneB 200 
chr22 5000 9000 cloneC 700 
chr22 6000 10000 cloneD 600
chr22 11000 15000 cloneE 300
chr22 13000 17000 cloneF 100 

Sharing your annotation track with others
The previous steps showed you how to upload annotation data for your own use on your own machine. However, many users would like to share their annotation data with members of their research group on different machines or with colleagues at other sites. To make your Genome Browser annotation track viewable by others, follow the steps below. (Note that some of the URL examples in this section have been broken up into 2 lines for documentation display purposes).

Step 1. Put your formatted annotation file on your web site. Be sure that the file permissions allow it to be read by others.

Step 2. Construct a URL that will link this annotation file to the Genome Browser. The URL must contain 3 pieces of information specific to your annotation data:

• The genome assembly on which your annotation data is based. This information is of the form db=database_name, where database_name is to the UCSC code for the genome assembly. For a list of these codes, see the Genome Browser FAQ. Examples of this include: db=hg11 (Human April 2002 assembly), db=mm2 (Mouse Feb 2002 assembly).
• The genome position that the Genome Browser should initially open to. This information is of the form position=chr_position, where chr_position is a chromosome number, with or without a set of coordinates. Examples of this include: position=chr22, position=chr22:15916196-31832390.
• The URL of the annotation file on your web site. This information is of the form hgt.customText=URL, where URL points to the annotation file on your website. An example of an annotation file URL is http://genome.ucsc.edu/goldenPath/help/test.bed.

Combine the above pieces of information into a URL of the following format (the information specific to your annotation file is highlighted):

http://genome.ucsc.edu/cgi-bin/hgTracks?db=database_name&
position=chr_position&hgt.customText=URL.

Example:
The following URL will open up the Genome Browser window to display chr 22 of the April 2002 assembly of the human genome (hg11), and will display the annotation track pointed to by the URL http://genome.ucsc.edu/goldenPath/help/test.bed:

http://genome.ucsc.edu/cgi-bin/hgTracks?db=hg11&position=chr22&
hgt.customText=http://genome.ucsc.edu/goldenPath/help/test.bed

If you'd like to share your annotation track with a broader audience, send the URL for your track - along with a description of the format, methods, and data used - to the UCSC Genome mailing list genome@soe.ucsc.edu.

Tips for viewing annotation track data

--	To display a description page with more information about the track, click on the mini-button to the left of a track.
--	To display a details page with additional information about a specific line item within a track in full display mode, click on the item or its label.
--	A track does not appear in the browser if its display mode is set to hide. To restrict the browser's display to only those tracks in which you're interested, set the display mode of the unwanted tracks to hide.
--	A track set to full display mode will default to a more tightly packed display mode if the total number of lines in the track exceeds 250.
--	To quickly toggle between full and dense or pack display modes, click on the track's center label.
--	Only the most recent assemblies are fully active. Older assemblies are archived.
--	Not all tracks appear in all assemblies. Only a basic set of tracks appears initially in a new assembly.
--	Track data can be viewed equivalently in columns as text tables using the Table Browser.
--	Credit goes to many individuals and institutions for generously contributing the tracks. For specific information about the contributors to a given track, look at the track's description page.

2X Reg Potential
This track displays the 2-way regulatory potential (RP) score computed from alignments of the human and mouse assemblies. RP scores compare frequencies of short alignment patterns between regulatory elements and neutral DNA.

--	Display conventions: This track uses the display conventions for wiggle tracks.
--	Table details: To view a text version of the data set, select the regPotential2X positional table in the Table Browser. To view the table definition, click here.

3X Reg Potential
This track displays the 3-way regulatory potential (RP) score computed from alignments of the human, mouse, and rat assemblies. RP scores compare frequencies of short alignment patterns between regulatory elements and neutral DNA.

--	Display conventions: This track uses the display conventions for wiggle tracks.
--	Table details: To view a text version of the data set, select the regPotential3X positional table in the Table Browser. To view the table definition, click here.

Acembly Genes
This track shows gene models reconstructed solely from mRNA and EST evidence by Danielle and Jean Thierry-Mieg and Vahan Simonyan using the Acembly program. Acembly attempts to find the best alignment of each mRNA against the genome, and considers alternative splice models. If more than one gene model is produced that has statistical significance, all of these models are displayed.

--	Display conventions: This track uses the display conventions for gene prediction tracks.
--	Track details: Clicking on an entry in full display mode will show position information, links to translated protein, predicted mRNA, and genomic sequence, and a link to an extensive text and graphical annotation of supporting data at NCBI's AceView.
--	Table details: To view a text version of the data set, select the acembly positional table in the Table Browser. To view the table definition, click here.

Affy GNF1H
This track shows the location of the sequences used for the selection of probes on Affymetrix GNF1H chips.

--	Display conventions: This track follows display conventions similar to mRNA tracks.
--	Track details: In dense or packed display mode, the track shows averages of related tissues. In full display mode, all tissues are displayed. Click on an individual tissue entry to show a gene expression map for all tissues in the experiment.
--	Table details: To view a text version of the data set, select the affyGnf1h positional table in the Table Browser. To view the table definition, click here.

Affy GNF1M
This track shows the location of the sequences used for the selection of probes on Affymetrix GNF1M chips.

--	Display conventions: This track follows display conventions similar to mRNA tracks.
--	Track details: In dense or packed display mode, the track shows averages of related tissues. In full display mode, all tissues are displayed. Click on an individual tissue entry to show a gene expression map for all tissues in the experiment.
--	Table details: To view a text version of the data set, select the affyGnf1m positional table in the Table Browser. To view the table definition, click here.

Affy GNF1H
This track shows the location of the sequences used for the selection of probes on Affymetrix GNF1M chips.

--	Display conventions: This track follows display conventions similar to mRNA tracks.
--	Track details: In dense or packed display mode, the track shows averages of related tissues. In full display mode, all tissues are displayed. Click on an individual tissue entry to show a gene expression map for all tissues in the experiment.
--	Table details: To view a text version of the data set, select the affyGnf1m positional table in the Table Browser. To view the table definition, click here.

Affy MOE430
This track shows the location of the sequences used for the selection of probes on the Affymetrix Mouse MOE430 set of chips (A and B).

--	Display conventions: This track follows display conventions similar to mRNA tracks.
--	Track details: Clicking on an item in one of the fuller modes displays positional and % identity information.
--	Table details: To view a text version of the data set, select the affyMOE430 positional table in the Table Browser. To view the table definition, click here.

Affy RAE230
This track shows the location of the sequences used for the selection of probes on Affymetrix RAE230 chips.

--	Display conventions: This track follows display conventions similar to mRNA tracks.
--	Track details: In dense or packed display mode, the track shows averages of related tissues. In full display mode, all tissues are displayed. Click on an individual tissue entry to show a gene expression map for all tissues in the experiment.
--	Table details: To view a text version of the data set, select the affyRAE230 positional table in the Table Browser. To view the table definition, click here.

Affy RG-U34A
This track shows the location of the sequences used for the selection of probes on Affymetrix RG-U34A chips.

--	Display conventions: This track follows display conventions similar to mRNA tracks.
--	Track details: In dense or packed display mode, the track shows averages of related tissues. In full display mode, all tissues are displayed. Click on an individual tissue entry to show a gene expression map for all tissues in the experiment.
--	Table details: To view a text version of the data set, select the affyU34A positional table in the Table Browser. To view the table definition, click here.

Affy U74
This track shows the location of sequences used for the selection of probes on the Affymetrix MG-U74v2 set of chips (A, B, and C).

--	Display conventions: This track follows display conventions similar to mRNA tracks.
--	Track details: Clicking on an item in one of the fuller modes displays positional and % identity information.
--	Table details: To view a text version of the data set, select the affyU74 positional table in the Table Browser. To view the table definition, click here.

Affy U95
This track shows the location of the consensus and exemplar sequences used for the selection of probes on the Affymetrix HG-U95Av2 chip.

--	Display conventions: This track follows display conventions similar to mRNA tracks.
--	Track details: Clicking on an item in one of the fuller modes displays positional and % identity information.
--	Table details: To view a text version of the data set, select the affyU95 positional table in the Table Browser. To view the table definition, click here.

Affy U133
This track shows the location of the consensus and exemplar sequences used for the selection of probes on the Affymetrix HG-U133A and HG-U133B chips.

--	Display conventions: This track follows display conventions similar to mRNA tracks.
--	Track details: Clicking on an item in one of the fuller modes displays positional and % identity information.
--	Table details: To view a text version of the data set, select the affyU133 positional table in the Table Browser. To view the table definition, click here.

Affy U133Plus2
This track shows the location of the consensus and exemplar sequences used for the selection of probes on the Affymetrix HG-U133 Plus 2.0 chip.

--	Display conventions: This track follows display conventions similar to mRNA tracks.
--	Track details: Clicking on an item in one of the fuller modes displays positional and % identity information.
--	Table details: To view a text version of the data set, select the affyU133Plus2 positional table in the Table Browser. To view the table definition, click here.

Affy Zebrafish (Zebrafish)
This track shows the location of the sequences used for the selection of probes on the Affymetrix Zebrafish chip.

--	Display conventions: This track follows display conventions similar to mRNA tracks.
--	Track details: In dense or packed display mode, the track shows averages of related tissues. In full display mode, all tissues are displayed. Click on an individual tissue entry to show a gene expression map for all tissues in the experiment.
--	Table details: To view a text version of the data set, select the affyZebrafish positional table in the Table Browser. To view the table definition, click here.

All Ciona ESTs
See the description for Human ESTs.

Alt-Splicing
This track summarizes the alternative splicing shown in the mRNA and EST tracks.

--	Display conventions: Exons are represented by blocks; possible splice junctions by lines. In full mode with the resolution set to approximately gene-level, alternative exons are laid out with minimal overlap and are therefore easier to view. The level of shading of exons and splice junctions reflects the quantity of ESTs and mRNAs that contain that exon or splice junction.
--	Track details: Clicking on an item in one of the fuller modes displays positional information and alt-splicing plots, as well as a link to a zoomed-in browser view of that feature.
--	Table details: To view a text version of the data set, select the altGraphX positional table in the Table Browser. To view the table definition, click here.

A. gambiae Chain
This track shows A. gambiae genomic alignments to the selected genome using blastz and axtChain. See the Human Chain track description for more information.

A. gambiae ESTs
See the description for Human ESTs.

A. gambiae mRNAs
See the description for Human mRNAs.

A. gambiae Net
This track shows the best A. gambiae chain for every part of the selected genome. See the Human Net track description for more information.

A. mellifera Chain
This track shows A. mellifera genomic alignments to the selected genome using blastz and axtChain. See the Human Chain track description for more information.

A. mel. ESTs
A. mellifera ESTs. See the description for Human ESTs.

A. mel. mRNAs
A. mellifera mRNAs. See the description for Human mRNAs.

A. mellifera Net
This track shows the best A. mellifera chain for every part of the selected genome. See the Human Net track description for more information.

Anopheles Ecores
This track shows Anopheles evolutionary conserved regions (ecores) computed against the selected assembly genome by the Exofish program at Genoscope. For information on this track, see the Human Ecores track description.

Assembly
This track shows the draft assembly of the human genome. This assembly merges contigs from overlapping draft and finished clones into longer sequence contigs. The sequence contigs are ordered and oriented when possible by mRNA, EST, paired plasmid reads (from the SNP Consortium) and BAC end sequence pairs.

--	Display conventions: In dense display mode, this track depicts in alternating gold and brown the path through the draft and finished clones (aka the golden path) used to create the assembled sequence. Individual boxes show the assembly extractable from a single clone fragment. Where gaps exist in the path, spaces are shown between the gold and brown blocks. If the relative order and orientation of the contigs between the two blocks is known, a line is drawn to bridge the blocks. The display must be sufficiently zoomed in to view the gap and bridge features.
--	Track details: Clicking on an item in full display mode will show information about the clone fragment and bases, position information, and the DNA sequence corresponding to the fragment.
--	Table details: To view a text version of the data set, select the gold positional table in the Table Browser. To view the table definition, click here.

BAC End Pairs
This track shows the genome sequence of bacterial artificial chromosomes (BACs) in which a small amount of the both ends have been sequenced to place the full insert on the assembly. A valid pair of BAC end sequences must be separated by at least 50Kb but no more than 600Kb, and must have opposite orientations. Strand assignment follows Clone Registry storage conventions. The BAC end sequences are placed on the assembled sequence using BLAT.

--	Display conventions: The sequenced BAC ends are represented by black boxes connected by a line with hatch marks indicating the direction of transcription.
--	Track details: Clicking on an entry in full display mode will show hyperlinks to the NCBI clone registry and GenBank, position information, and genomic alignments.
--	Table details: To view a text version of the data set, select the bacEndPairs positional table in the Table Browser. To view the table definition, click here.

Bactigs
The rat genome assembly is pieced together from bactig assemblies rather than clone-by-clone assemblies. Bactigs are reassemblies of the reads from sets of overlapping skimmed BAC clones, including mapped whole shotgun reads. The assembly process reworks the contigs (splitting some) and selects them under more stringent criteria than is used for the BAC submissions.

--	Display conventions: Bactig positions are indicated by rectangular blocks. Bactig names are of the form gaab_gnmm, the internal names of the two bracketing projects.
--	Track details: Clicking on an entry in full display mode will show position information and the first and last contig in the bactig.
--	Table details: To view a text version of the data set, select the bactigPos positional table in the Table Browser. To view the table definition, click here.

Base Position
Shows the chromosomal coordinates as numbered starting from the telomere of the short p arm. The coordinates differ between assemblies.

--	Display conventions: Clicking on a position in this track will zoom in the display by 3x, centered around the click. This track has only on and off modes, and no dense mode.
--	Track details: None.
--	Table details: None.

BDGP Genes (D. melanogaster)
This track shows protein-coding genes annotated by the Berkeley Drosophila Genome Project (BDGP). For a description of the methods used to generate the data, see the BDGP Methods web page.

--	Display conventions: This track uses the display conventions for known genes and gene predictions tracks.
--	Track details: Clicking on an entry in full display provides links to the corresponding protein, mRNA, and genomic sequences, and related links to outside databases.
--	Track configuration: The track description page contains a filter that can be used to turn on codon coloring for the track. Click the "Codon coloring help" link on the page for more information about this feature.
--	Table details: To view a text version of the data set, select the bdgpGene positional table in the Table Browser. To view the table definition, click here.

BDGP Insertions (D. melanogaster)
This track shows the locations of P transposable element insertions from P-Screen, the online database of the BDGP Gene Disruption Project. When a stock order number is available for the strain, a link is provided to the Bloomington stock center. The project's strain library contains more than 7140 strains disrupting at least 5362 different genes, corresponding to 39% of the 13,666 currently annotated Drosophila genes.

--	Display conventions: Triangular arrows on the reference sequence indicate the approximate locations where P elements have inserted themselves in the mutant strain. Left-pointing arrows indicate insertions that are oriented in a backwards direction; right-pointing arrows indicated forwards-oriented insertions. The item name indicates the strain having a P element disruption at that location.
--	Track details: Clicking on an entry in full display mode provides position and strand information, strain name, a link to the Bloomington stock center (when applicable), and a link to the underlying DNA for the feature.
--	Track configuration: The track description page allows the user to set the minimum unnormalized score of the data displayed in the track.
--	Table details: To view a text version of the data set, select the pscreen positional table in the Table Browser. To view the table definition, click here.

BDGP Non-Coding Genes (D. melanogaster)
This track shows non-coding genes annotated by the Berkeley Drosophila Genome Project (BDGP). For a description of the methods used to generate the data, see the BDGP Methods web page.

--	Display conventions: This track uses the display conventions for known genes and gene predictions tracks.
--	Track details: Clicking on an entry in full display provides links to the corresponding protein, mRNA, and genomic sequences, and related links to outside databases.
--	Track configuration: The track description page contains a filter that can be used to turn on codon coloring for the track. Click the "Codon coloring help" link on the page for more information about this feature.
--	Table details: To view a text version of the data set, select the bdgpNonCoding positional table in the Table Browser. To view the table definition, click here.

Best Human
This track displays Blastz alignments of the Nov. 2002 human draft assembly to the mouse genome filtered to display only the best alignment for any given region of the mouse genome. See the track's description page for more details.

--	Display conventions: This track uses the display conventions for cross-species synteny tracks.
--	Track details: Clicking on an entry in full display mode will show mouse and human position information, alignment details, and a link to a detailed view of parts of the alignment.
--	Track configuration: The track description page contains a filter that can be used to turn on the chromosome color track or to filter the display output by chromosome.
--	Table details: To view a text version of the data set, select the blastzBestHuman positional table in the Table Browser. To view the table definition, click here.

Best Mouse
This track displays Blastz alignments of the specified mouse draft assembly to the human genome filtered to display only the best alignment for any given region of the human genome. See the track's description page for more details.

--	Display conventions: This track uses the display conventions for cross-species synteny tracks.
--	Track details: Clicking on an entry in full display mode will show human and mouse position information, alignment details, and a link to a detailed view of parts of the alignment.
--	Track configuration: The track description page contains a filter that can be used to turn on the chromosome color track or to filter the display output by chromosome.
--	Table details: To view a text version of the data set, select the blastzBestMouse positional table in the Table Browser. To view the table definition, click here.

Best Rat
This track displays Blastz alignments of the Nov. 2002 rat draft assembly to the mouse genome filtered to display only the best alignment for any given region of the mouse genome. See the track's description page for more details.

--	Display conventions: This track uses the display conventions for cross-species synteny tracks.
--	Track details: Clicking on an entry in full display mode will show rat and mouse position information, alignment details, and a link to a detailed view of parts of the alignment.
--	Track configuration: The track description page contains a filter that can be used to turn on the chromosome color track or to filter the display output by chromosome.
--	Table details: To view a text version of the data set, select the blastzBestRat positional table in the Table Browser. To view the table definition, click here.

BGI Coverage
This track shows areas of coverage for genomic regions of 3 alternate strains of chicken sequenced by the Beijing Genomics Institute (BGI): Broiler, Layer, and Silkie. Single reads from those three strains were mapped to the reference assembly for the Red Jungle Fowl (RJF).

--	Display conventions: Coverage regions are represented by solid blocks.
--	Track details: Clicking on an entry in full display mode shows position information and a link to the DNA underlying this feature.
--	Table details: To view a text version of the data set, select the bgiCov positional table in the Table Browser. To view the table definition, click here.

BGI Genes
This track shows protein-coding genes annotated by the Beijing Genomics Institute (BGI). If Single Nucleotide Polymorphisms (SNPs) and/or insertions/deletions from BGI have been associated with a gene, those SNPs are listed with links to their details pages.

--	Display conventions: This track uses the display conventions for known genes and gene predictions tracks.
--	Track details: Clicking on an entry in full display mode shows position information, GO and InterPro terms from BGI, BGI SNPs associated with the gene, and links to the predicted protein, mRNA, and genomic sequences.
--	Table details: To view a text version of the data set, select the bgiGene positional table in the Table Browser. To view the table definition, click here.

BGI SNPs
This track shows the single nucleotide polymorphisms (SNPs) and/or insertions/deletions (indels) determined by the Beijing Genomics Institute (BGI). Genomic sequence reads from 3 alternate strains of chicken (Broiler, Layer and Silkie) were used to determine the SNPs relative to the reference assembly for the Red Jungle Fowl (RJF). SNPs and indels are associated with genes (annotations by BGI until Ensembl annotations are ready). Information on the association can be displayed along with a link to the details page for the gene.

--	Display conventions: SNP locations are indicated by thin vertical lines. SNP names are of the format [supercontig].[contig].[position].[type].[strain]. See the track description page for more information.
--	Track details: Clicking in full display mode shows information position and SNP information, primer sequences, and a link to the DNA underlying the feature.
--	Table details: To view a text version of the data set, select the bgiSnp positional table in the Table Browser. To view the table definition, click here.

Binomial Cons
This track displays the conservation scores resulting from an analysis of Zoo blastz alignments. Conservation scores were generated by weighing the relative contribution of each species sequence to the overall conservation score, based on how diverged each species was from the reference sequence. This weighting scheme was determined by calculating the neutral substitution rates at 4-fold degenerate positions.

--	Display conventions: This track uses the display conventions for wiggle tracks.
--	Track configuration: The track description page contains options to configure several of the graph characteristics. To read more information about each option, click the "Graph configuration help" link.
--	Track details: Clicking on one of the peaks in the track when in full display mode will show genome position information for the window and a link to the underlying DNA sequence. In full mode in a zoomed-out display, detailed information may not be accessible for an individual feature. In this case, zoom in and try again.
--	Table details: To view a text version of the data set, select the binomialCons2 positional table in the Table Browser. To view the table definition, click here.

Blastz Mouse
This track displays blastz alignments of the specified mouse draft assembly to the selected genome.

--	Display conventions: This track uses the display conventions for cross-species synteny tracks.
--	Track details: Clicking on an entry in full display mode will position information for the mouse and the selected genome, alignment details, and a link to a detailed view of parts of the alignment.
--	Track configuration: The track description page contains a filter that can be used to turn on the chromosome color track or to filter the display output by chromosome.
--	Table details: To view a text version of the data set, select the blastzX positional table in the Table Browser, where X represents the assembly version in which you are interested, e.g. Mm4). To view the table definition, click here.

Briggsae Aligns
This track shows best-in-genome C. elegans/C. briggsae alignments based on the C. elegans/C. briggsae alignment net, i.e. the best chain for every part of the C. elegans genome. See the D. pseud Aligns track description for more information.

Briggsae Blastz
This track displays Blastz alignments of the C. briggsae assembly to selected assembly. See the Blastz Mouse track description for more information.

Briggsae Chain
This track shows C. briggsae genomic alignment to the selected genome using blastz and axtChain. See the Human Chain track description for more information.

Briggsae Net
This track shows the best C. briggsae chain for every part of the selected genome. See the Human Net track description for more information.

Briggsae Waba
This track shows alignments of C. briggsae to C. elegans using the Wobble Aware Bulk Aligner (WABA), an alignment tool developed by Jim Kent for doing large-scale alignments between genomic DNA of different species.

--	Display conventions: Aligning regions are represented by blocks. The shading indicates the hidden Markov model (HMM) states of the bases.
--	Track details: Clicking on an item in full display mode will show alignment details and the HMM state for each alignment pair`. Markov model .
--	Table details: To view a text version of the data set, select the wabaCbr positional table in the Table Browser. To view the table definition, click here.

C. briggsae ESTs
See the description for Human ESTs.

C. briggsae mRNAs
See the description for Human mRNAs.

C. elegans ESTs
See the description for Human ESTs.

C. elegans mRNAs
See the description for Human mRNAs.

Chicken Chain
This track shows chicken genomic alignment to the selected genome using blastz and axtChain. See the Human Chain track description for more information.

Chicken ESTs
See the description for Human ESTs.

Chicken mRNAs
See the description for Human mRNAs.

Chicken Net
This track shows the best chicken chain for every part of the selected genome. See the Human Net track description for more information.

Chimp BAC Ends
This track displays BAC alignments of the chimp genome (Pan troglodytes) to human, based on BLAT alignments from Ingo Ebersberger, Joshua Bacher, and Svante Pääbo at the MPI for Evolutionary Anthropology.

--	Display conventions: This track follows the display conventions for BLAT tracks.
--	Track details: Clicking on an item will show details on the chimp sequence fragment and alignment details, as well as a link to more information on the track data.
--	Table details: To view a text version of the data set, select the chimpBac positional table in the Table Browser. To view the table definition, click here.

Chimp Blat
This track displays alignments of the chimp genome (Pan troglodytes) to human, based on Blat alignments from Ingo Ebersberger, Joshua Bacher, and Svante Pääbo at the MPI for Evolutionary Anthropology.

--	Display conventions: This track follows the display conventions for BLAT tracks.
--	Track details: Clicking on an item will show details on the chimp sequence fragment and alignment details, as well as a link to more information on the track data.
--	Table details: To view a text version of the data set, select the chimpBlat positional table in the Table Browser. To view the table definition, click here.

Chimp Chain
This track shows chimp genomic alignment to the selected genome using blastz and axtChain. See the Human Chain track description for more information.

Chimp Deletions
This track displays regions of the human assembly that are deleted in the chimp assembly. Only regions of between 80 and 12000 bases are included. The name of each deletion is a unique pointer to that deletion followed by an underscore and then its length. A similar track, showing human deletions in the chimp assembly, appears in the chimp Genome Browser.

--	Display conventions: Deletions are indicated by thin vertical lines.
--	Track details: Clicking on a deletion in full display mode provides the item name, position, genomic size, and a link to the DNA underlying the feature.
--	Table details: To view a text version of the data set, select the chimpDels positional table in the Table Browser. To view the table definition, click here.

Chimp Diff
This track shows simple differences between chimp alignments and the human assembly within regions of high quality chimp sequence. For a difference to be included in this track, it had to meet the following criteria:

• the difference must occur at a base of quality 30 or better
• all bases within an 11-base window around this base must have a quality of 25 or better
• the 11-base window must contain no more than two base differences
• no insertions or deletions may be present within the window

Chimp ESTs
See the description for Human ESTs.

Chimp mRNAs
See the description for Human mRNAs.

Chimp Recip Chain
This track displays "reciprocal best" human/chimpanzee genomic alignment chains. Track details: In full display mode, clicking on a box shows details information about the chain as a whole, while clicking on a line shows information about the gap. The detailed information is useful in determining the cause of the gap or, for lower level chains, the genomic rearrangement.

--	Display conventions: This track uses the display conventions for chain tracks.
--	Table details: To view a text version of the data set, select the rBestChainPanTro1 positional table in the Table Browser. To view the table definition, click here.

Chimp Recip Net
This track shows the reciprocal best alignment net between the chimpanzee and the selected genome assembly. Due to the draft nature of the initial chimp assembly, this track uses a "reciprocal best" strategy that attempts to minimize paralog fill-in for missing orthologous chimp sequence by filtering out of the human net all sequences not in the chimp side of the net. See the track description page for more information about the methods used to generate this track.

--	Display conventions: This track uses the display conventions for net tracks.
--	Track details: In full display mode, clicking on a box shows details information about the chain as a whole, while clicking on a line shows information about the gap. The detailed information is useful in determining the cause of the gap or, for lower level chains, the genomic rearrangement.
--	Table details: To view a text version of the data set, select the rBestNetPanTro1 positional table in the Table Browser, where X is the assembly version in which you're interested. To view the table definition, click here.

Chromosome Band
The light and dark blocks indicate the approximate location of traditional cytological bands seen on Giemsa-stained chromosomes at an 850 band resolution. The bands were mapped by fluorescent in situ hybridization (FISH) of large-insert clones with sequence tags, STS markers, and BAC end sequence locations. resolution of 862 bands genome-wide. The uncertainty of mapping to band staining is still a megabase or more.

--	Display conventions: The light and dark blocks indicate the approximate location of the bands on the assembly sequence.
--	Track details: Clicking on a band in full display mode will show more details about the track, a discussion of mapping methods used, and lab credits.
--	Table details: To view a text version of the data set, select the cytoBand positional table in the Table Browser. To view the table definition, click here.

C. intestinalis ESTs
See the description for Human mRNAs.

C. intestinalis mRNAs
See the description for Human mRNAs.

Ciona mRNAs
See the description for Human mRNAs.

Conservation
This track shows a measure of evolutionary conservation among several species, based on a phylogenetic hidden Markov model (phylo-HMM). The multiz alignments of the various assemblies were used to construct the annotation. The raw conservation scores used to generate this track can be downloaded from the [assembly_name]/phastCons directory on the Genome Browser FTP server.

--	Display conventions: In full display mode, the track displays pairwise alignments of several species aligned to the human genome. The pairwise alignments are displayed in standard UCSC browser "dense" mode using a grey-scale density gradient. When zoomed-in to the base-display level, the track shows the base composition of each alignment. The numbers and symbols on the "human gap" line indicate the lengths of gaps in the human sequence at those alignment positions. If the gap size is greater than 9, the "+" symbol is displayed. The track must be zoomed-in to 30,000 or fewer bases to access detailed information about the alignments at a specific position.
--	Track details: Clicking on an entry in full display mode will show detailed alignment information for each of the organisms.
--	Table details: -- To view an index of the multiz multiple alignment data used to generate this track, select one of the following positional tables from the Table Browser: multiNway (most recent assemblies), mz*_pHMM (hg16), mz*_phast (canFam1, dm1), c_briggsae_pwMaf (C. elegans). -- To view the wiggle track data used to generate the conservation display, select onf of the following positional tables: phastCons (most assemblies), mz*_wig (hg16), mz*phast_wig (canFam1, dm1). -- To download the raw conservation scores displayed in the Conservation track, download the data files from the [assembly_name]/phastCons directory on the Genome Browser FTP server. -- To view the table definition for the multiz multiple alignment tables, click here. -- To view the table definition for the phastCons tables, click here.

Contamination (Chicken)
This track shows locations of likely contamination in the chicken (galGal2) assembly, i.e. high-scoring alignments of E.coli, vector and maize mitochondrion sequence. The name of each feature indicates the type of contamination found there.

--	Display conventions: Area of contamination are represented by solid blocks.
--	Track details: Clicking on an entry in full display mode will show the type of contamination, position and size information, and a link to display the DNA for the feature.
--	Table details: To view a text version of the data set, select the contamination positional table in the Table Browser. To view the table definition, click here.

Contigs (Zebrafish)
This track shows the whole genome shotgun (WGS) contigs of the zebrafish assembly from The Wellcome Trust Sanger Institute.

--	Display conventions: Contigs are represented by blocks that indicate their location on the assembly sequence.
--	Track details: Clicking on an item in full display mode will show contig and positional information.
--	Table details: To view a text version of the data set, select the ctgPos2 positional table in the Table Browser. To view the table definition, click here.

Coverage
Shows the coverage level and positions of all clones in the genome.

--	Display conventions: In dense display mode, this track shows the coverage level of the genome. Finished regions are shown in black. Draft regions are shown in various shades of gray that correspond to the level of coverage: o White: no coverage (gap) o Light Gray: predraft (less than 4x shotgun) o Medium Gray: draft (at least 4x shotgun) o Dark Gray: covered by multiple draft clones o Black: covered by a finished clone
	In full display mode, this track shows the position of each clone that aligns to the genome sequence. Finished clones are shown in black and unfinished clones are shown in gray. In assemblies prior to the April 2003 human release, coverage for each unfinished clone is represented as a two-tiered gray box. The fragments inside the clone are shown as numbered black boxes. Their positions correspond to their relative assembly placement, including strand assignment. For some assemblies, clones in the sequencing center tiling path are shown with blue rather than gray backgrounds.
--	Track details: Clicking on an item in full display mode will show the clone hyperlink to GenBank record and the fasta format sequence (one per fragment).
--	Table details: To view a text version of the data set, select the clonePos positional table in the Table Browser. To view the table definition, click here.

Cow Chain
This track shows cow genomic alignments to the selected genome using blastz and axtChain. See the Human Chain track description for more information.

Cow ESTs
See the description for Human ESTs.

Cow mRNAs
the description for Human mRNAs.

Cow Net
This track shows the best cow chain for every part of the selected genome. See the Human Net track description for more information.

CpG Islands
This track shows CpG islands, areas rich in the dinucleotide CG. A CpG island is a region where C's followed by G's (CpGs) are present at significantly higher levels than is typical for the genome as a whole. The CpG islands displayed in this browser are all at least 200 bases long, and have a GC content of at least 50%.

CpG islands are associated with genes, particularly housekeeping genes, in vertebrates. They are particularly common near transcription start sites, and may be associated with promoter regions. Normally a CpG is rare in vertebrate DNA because the C's in such an arrangement tend to be methylated. This methylation helps distinguish the newly synthesized DNA strand from the parent strand, which aids in the final stages of DNA proofreading after duplication. However, over evolutionary time, methylated C's tend to turn into T's due to spontaneous deamination. The result is that CpGs are relatively rare unless there is selective pressure to keep them or a region is not methylated for some reason, perhaps having to do with the regulation of gene expression.

--	Display conventions: CpG islands are represented by green boxes. Darker green items indicate CpG islands that contain 300 or more bases.
--	Display conventions: Clicking on a CpG entry in full display mode will show basic track information, detailed information about the CpG island, and sequence information.
--	Table details: To view a text version of the data set, select the cpgIsland positional table in the Table Browser. To view the table definition, click here.

C. savignyi Blat
This track displays translated BLAT alignments of the C. savignyi genome against the C. intestinalis genome assembly. The alignments were done with Blat in translated protein mode requiring 2 nearby 4-mer matches to trigger a detailed alignment. The C. intestinalis genome was masked with RepeatMasker and Tandem Repeats Finder before running Blat.

--	Display conventions: This track uses the display conventions for BLAT tracks.
--	Track details: Clicking on an entry in full display mode displays links to the DNA sequence and the alignment.
--	Table details: To view a text version of the data set, select the blatCioSav1 positional table in the Table Browser. To view the table definition, click here.

Cytokine Genes (Tetraodon)
This track shows cytokine genes annotated by human experts using sequence similarity information between Tetraodon and human, mouse and zebrafish cytokine protein and nucleotide sequences. These annotations are available only on the following chromosomes: 1, 2, 3, 4, 7, 8, 10, 12, 13, 15, 16, 1_random, 3_random, and Un_random.

--	Display conventions: This track uses the display conventions for gene prediction tracks.
--	Track configuration: The track description page contains a control that can be used to turn on codon coloring.
--	Track details: Clicking on a track feature in full display mode shows position information and provides links to the translated protein, predicted mRNA, and genome sequences.
--	Table details: To view a text version of the data set, select the cytokines positional table in the Table Browser. To view the table definition, click here.

DBTSS mRNA
This track shows RefSeq mRNA sequences extended to the 5' end, based on sequence information in the DataBase of Transcriptional Start Sites (DBTSS). For more information on the process used to construct this track, refer to the track's description page.

--	Display conventions: This track uses the display conventions for mRNA tracks.
--	Track details: Clicking on an entry in full display mode will show PSL output information about the item.
--	Table details: To view a text version of the data set, select the dbtssAli positional table in the Table Browser. To view the table definition, click here.

D. mel. Chain
This track shows D. melanogaster genomic alignment to the selected genome using blastz and axtChain. See the Human Chain track description for more information.

D. mel. Net
This track shows the best D. melanogaster chain for every part of the selected genome. See the Human Net track description for more information.

D. mel. Proteins (A. gambiae, A. mellifera
This track contains tBLASTn alignments of the peptides from the predicted and known genes identified in the specified version of FlyBase.

--	Display conventions: This track uses the display conventions for mRNA tracks.
--	Track details: Clicking on an entry in full display mode will provide positional information, a link to the related FlyBase record, protein length, and links to the alignment and peptide sequences.
--	Table details: To view a text version of the data set, select the blastDm1FB positional table in the Table Browser. To view the table definition, click here.

D. melanogaster ESTs
See the description for Human ESTs.

D. melanogaster mRNAs
See the description for Human mRNAs.

DNAse HyperSens (Zoo)
This track depicts DNAse I hypersensitive sites (DHS) mapped to the human genome sequence. Each track element represents the surrounding 500 bp from the position of the estimated DHS, as determined from Smith et al. (2000) "Multiple Potential Intragenic Regulatory Elements in the CFTR Gene", Genomics 64(1):90-6.

--	Display conventions: Each DHS is depicted by a block representing the 500 bp surrounding the position of the estimated DHS.
--	Track details: Clicking on an entry in full display mode will show position information and a link to the underlying DNA sequence.
--	Table details: To view a text version of the data set, select the dhs positional table in the Table Browser. To view the table definition, click here.

Dog Chain
This track shows dog genomic alignment to the selected genome using blastz and axtChain. See the Human Chain track description for more information.

Dog ESTs
See the description for Human ESTs.

Dog mRNAs
See the description for Human mRNAs.

Dog Net
This track shows the best dog chain for every part of the selected genome. See the Human Net track description for more information.

D. ananassae Chain
This track shows D. ananassae genomic alignments to the selected genome using blastz and axtChain. See the Human Chain track description for more information.

D. anan. mRNAs
D. ananassae mRNAs. See the description for Human mRNAs.

D. ananassae Net
This track shows the best D. ananassae chain for every part of the selected genome. See the Human Net track description for more information.

D. mojavensis Chain
This track shows D. mojavensis genomic alignments to the selected genome using blastz and axtChain. See the Human Chain track description for more information.

D. moj. mRNAs
D. mojavensis mRNAs. See the description for Human mRNAs.

D. mojavensis Net
This track shows the best D. mojavensis chain for every part of the selected genome. See the Human Net track description for more information.

D. pseudo. Aligns (D. melanogaster)
This track shows blastz scores from the D. pseudoobscura/D. melanogaster alignment Net track, i.e. the best D. pseudoobscura/D. melanogaster chain for every part of the D. melanogaster genome.

--	Display conventions: In dense display mode, darker shading indicates those best chained and netted alignments that have the higher scores. In full display mode, the height of the vertical line corresponds to the score.
--	Track details: Clicking on an entry in full display mode will show position information and -- when zoomed in to the base level -- the base composition of the alignments.
--	Table details: To view a text version of the data set, select the axtNetX positional table in the Table Browser, where X represents the assembly that is being aligned, e.g. Dp1. To view the table definition, click here.

D. pseudo. Chain (D. melanogaster)
This track shows D. pseudoobscura genomic alignment to the selected genome using blastz and axtChain. See the Human Chain track description for more information.

D. pseudo. ESTs
D. pseudoobscura ESTs. See the description for Human ESTs.

D. pseudo. mRNAs
D. pseudoobscura mRNAs. See the description for Human mRNAs.

D. pseudo. Net (D. melanogaster)
This track shows the best D. pseudoobscura chain for every part of the selected genome. See the Human Net track description for more information.

D. virilis Chain
This track shows D. virilis genomic alignments to the selected genome using blastz and axtChain. See the Human Chain track description for more information.

D. vir. mRNAs
D. virilis mRNAs. See the description for Human mRNAs.

D. virilis Net
This track shows the best D. virilis chain for every part of the selected genome. See the Human Net track description for more information.

D. yakuba Chain
This track shows D. yakuba genomic alignments to the selected genome using blastz and axtChain. See the Human Chain track description for more information.

D. yakuba ESTs
D. yakuba ESTs. See the description for Human ESTs.

D. yakuba mRNAs
D. yakuba mRNAs. See the description for Human mRNAs.

D. yakuba Net
This track shows the best D. yakuba chain for every part of the selected genome. See the Human Net track description for more information.

Duplications
This track shows genomic duplications greater than 1,000 bp if not overly repeat-masked. Duplications are more common in unordered and unassigned contigs (i.e., difficult to assign to their proper position).

--	Display conventions: Duplications are show as red if 99%+ identity (likely unmerged assembly overlap artifact), as yellow for 98-99% identity (origin uncertain), and as gray for 90-98% identity (below draft sequencing error, often genuine pericentromeric or subtelomeric duplication).
--	Track details: In the left panel of the browser, duplications are named by the chromosome and start of the other member of the duplication pair. Clicking on an individual duplication gives details of both locations and match quality parameters.

D. yakuba ESTs
See the description for Human ESTs.

D. yakuba mRNAs
See the description for Human mRNAs.

ECgene Genes
This track shows gene predictions generated by combining genome-based EST clustering and transcript assembly methods. The EST clustering is based on genomic alignment of mRNA and ESTs similar to that of NCBI's UniGene for the human genome. The transcript assembly procedure yields gene models for each cluster that include alternative splicing variants. This algorithm was developed by Prof. Sanghyuk Lee's Lab of Bioinformatics at Ewha Womans University in Seoul, Korea. For more information, see the ECgene web site.

--	Display conventions: This track uses the display conventions for gene predictions tracks.
--	Track details: Clicking on an entry in full display mode brings up basic track information, links to the predicted mRNA, genomic sequence, and comparative sequence.
--	Table details: To view a text version of the data set, select the ECgene positional table in the Table Browser. To view the table definition, click here.

Elegans Blastz
This track displays Blastz alignments of the C. elegans assembly to the C. briggsae assembly

--	Display conventions: This track uses the display conventions for cross-species synteny tracks.
--	Track details: Clicking on an entry in full display mode will show human and mouse position information, alignment details, and a link to a detailed view of parts of the alignment.
--	Track configuration: The track description page contains a filter that can be used to turn on the chromosome color track or to filter the display output by chromosome.
--	Table details: To view a text version of the data set, select the blastzX positional table in the Table Browser, where X represents the C. elegans assembly, e.g. Ce2. To view the table definition, click here.

Elegans Chain
This track shows C. elegans genomic alignment to the selected genome using blastz and axtChain. See the Human Chain track description for more information.

ENCODE Regions
This track depicts target regions for the NHGRI ENCODE project, which is described in The ENCODE Project: ENCyclopedia of DNA Elements. The long-term goal of this project is to identify all functional elements in the human genome sequence to facilitate a better understanding of human biology and disease. During the pilot phase, 44 regions comprising 30 Mb -- approximately 1% of the human genome -- have been selected for intensive study to identify, locate and analyze functional elements within the regions. These targets are being studied by a diverse public research consortium to test and evaluate the efficacy of various methods, technologies, and strategies for locating genomic features. The outcome of this initial phase will form the basis for a larger-scale effort to analyze the entire human genome. See the track description page for more information.

--	Display conventions: ENCODE regions are represented by blocks.
--	Track details: Clicking on an item in full display mode shows position information and provides a link to the DNA sequence associated with this feature.
--	Table details: To view a text version of the data set, select the encodeRegions positional table in the Table Browser, where X is the assembly version in which you're interested. To view the table definition, click here.

Ensembl ESTs
This track shows gene predictions from Project Ensembl based on ESTs. For a description of the methods used in Ensembl gene prediction, refer to The Ensembl genome database project, Nucleic Acids Research, 2002, 30(1) 38-41.

--	Display conventions: This track uses the display conventions for gene predictions tracks.
--	Track details: Clicking on an entry in full display mode brings up basic track information, links to the translated protein, predicted mRNA, and genomic sequences, plus a link to detailed supporting evidence.
--	Table details: To view a text version of the data set, select the ensEst positional table in the Table Browser. To view the table definition, click here.

Ensembl Genes
This track shows gene predictions from Project Ensembl. For a description of the methods used in Ensembl gene prediction, refer to The Ensembl genome database project, Nucleic Acids Research, 2002, 30(1) 38-41.

--	Display conventions: This track uses the display conventions for gene predictions tracks.
--	Track details: Clicking on an entry in full display mode brings up basic track information, links to the translated protein, predicted mRNA, and genomic sequences, plus a link to detailed supporting evidence.
--	Table details: To view a text version of the data set, select the ensGene positional table in the Table Browser. To view the table definition, click here.

Exofish ecores
The track displays conserved regions, generally protein-coding homologs, from a genomics project of long random reads in the pufferfish, Tetraodon nigroviridis. Ecore is an acronym for evolutionary conserved region. The data was used to estimate the number of human genes.

--	Display conventions: Regions of greater homology are displayed in a darker blue.
--	Track details: Clicking on an entry in full mode brings up information on a particular ecore, access the relevant Genoscope page, and the relevant DNA.
--	Table details: To view a text version of the data set, select the exoFish positional table in the Table Browser. To view the table definition, click here.

Exoniphy
The exoniphy program identifies evolutionarily conserved protein-coding exons in multiple sequences aligned with multiz using a phylogenetic hidden Markov model (phylo-HMM), a statistical model that simultaneously describes exon structure and exon evolution.

--	Display conventions: Evoluntionarily-conserved protein-coding exons are represented by blocks. Arrows indicated the direction of transcription.
--	Track details: Clicking on an entry in full mode displays positional information and related sequence links.
--	Table details: To view a text version of the data set, select the exoniphy positional table in the Table Browser. To view the table definition, click here.

Fgenesh++ Genes
This tracks shows Fgenesh++ gene predictions based on Softberry Inc.'s gene-finding software. Fgenesh++ uses both hidden Markov models (HMMs) and protein similarity to find genes in a completely automated manner, with less emphasis on cDNA/EST data. See the paper "Ab initio gene finding in Drosophila genomic DNA", Genome Research 10(4) 516-522 for more information.

NOTE: The data in the softberryGene.txt and softberryPep.txt tables is free for academic and nonprofit use. Commercial users should contact Softberry Inc..

--	Display conventions: This track uses the display conventions for gene predictions tracks.
--	Track details: Clicking on an entry in full display mode brings up basic track information, links to the translated protein, predicted mRNA, and genomic sequences, plus a link to the best matching protein at GenBank.
--	Table details: To view a text version data set, select the softberryGene positional table in the Table Browser. To view the table definition, click here.

First EF
This track displays predictions from First Exon Finder (FirstEF), a 5' terminal exon and promoter prediction program. Three types of predictions are shown: exon, promoter and CpG window. If two consecutive predictions are separated by less than 1000 bp, FirstEF treats them as one cluster of alternative first exons that may belong to same gene. Each predicted exon is either CpG-related or non-CpG-related, based on a score of the frequency of CpG dinucleotides. An exon is classified as CpG-related if the CpG score is greater than a threshhold value and non-CpG-related if less than the threshold. If an exon is CpG-related, its associated CpG-window is displayed.

--	Display conventions: This track uses the display conventions for BLAT tracks. Higher CpG scores are shown in darker shades of gray/black. The cluster number is displayed in parentheses in the item label. For example, "exon(405-)" represents the exon prediction in cluster number 405 on the minus strand. The exon, promoter and CpG-window are interconnected by this cluster number. Alternative predictions within the same cluster are denoted by "#N" where "N" is the serial number of an alternative prediction in the cluster.
--	Track details: Clicking on an entry in full display mode displays probability, size, and position information, and a link to the DNA sequence.
--	Table details: To view a text version of the data set, select the firstEF positional table in the Table Browser. To view the table definition, click here.

Fish Blat
This track displays translated alignments of 728 million bases of Tetraodon nigroviridis whole genome shotgun reads vs. the draft human genome. Areas painted by this track are quite likely to be coding regions. The alignments were done with BLAT in translated protein mode requiring 2 nearby 4-mer matches to trigger a detailed alignment. The human genome was masked with RepeatMasker and Tandem Repeats Finder before running BLAT. The Tetraodon sequence was provided by Genoscope.

--	Display conventions: This track uses the display conventions for BLAT tracks.
--	Track details: Clicking on an entry in full display mode brings up links to the DNA sequence and the alignment.
--	Table details: To view a text version of the data set, select the blatFish positional table in the Table Browser. To view the table definition, click here.

FISH Clones
Shows the location of fluorescent in situ hybridization (FISH) mapped clones along the draft assembly sequence.

--	Display conventions: The green blocks depict the clone placements on the assembly sequence.
--	Track details: Clicking on a specific marker in full display mode will show information on clone placement, clone registry, its STS markers, and BAC end sequences.
--	Table details: To view a text version of the data set, select the fishClones positional table in the Table Browser. To view the table definition, click here.

FlyBase Genes (D. melanogaster)
This track shows protein-coding genes annotated by FlyBase (version 3.2).

--	Display conventions: This track uses the display conventions for gene predictions tracks.
--	Track details: Clicking on an entry in full display provides links to the corresponding protein, mRNA, and genomic sequences, microarray expression data, protein structure information, homology information and related links to several tools and databases, including FlyBase.
--	Table details: To view a text version of the data set, select the bdgpGene positional table in the Table Browser. To view the table definition, click here.

FlyBase Non-coding (D. melanogaster)
This track shows non-coding genes annotated by FlyBase (version 3.2).

--	Display conventions: This track uses the display conventions for gene predictions tracks.
--	Track details: Clicking on an entry in full display provides links to FlyBase and BDGP, basic track information, and links to the corresponding predicted genomic and predicted mRNA sequences.
--	Table details: To view a text version of the data set, select the bdgpGene positional table in the Table Browser. To view the table definition, click here.

FlyReg (D. melanogaster)
This track shows DNase I Footprint data from the FlyReg version 2.0 database. FlyReg provides access to results of the systematic curation and genome annotation of 1,350 DNase I footprints for the fruitfly D. melanogaster reported in Bergman, C.M. et al., Drosophila DNase I footprint database: a systematic genome annotation of transcription factor binding sites in the fruitfly, D. melanogaster, Bioinformatics 2004 Nov. 30 [Epub ahead of print].

--	Display conventions: Footprint regions are represented by blocks.
--	Track details: Clicking on an entry in full display provides footprint information, links to external databases, and a link to view the related genomic DNA. When available, a footprint motif is also displayed, based on a MEME matrix computed by Dan Pollard on the set of footprints for the factor.
--	Table details: To view a text version of the data set, select the flyreg2 positional table in the Table Browser. To view the table definition, click here.

Fosmid End Pairs
A valid pair of fosmid end sequences must be at least 32Kb but no more than 47Kb away from each other. The orientation of the first fosmid end sequence must be "+" and the orientation of the second fosmid end sequence must be "-". End sequences were trimmed at the NCBI using ssahaCLIP written by Jim Mullikan. The trimmed end sequences were placed on the assembled sequence using Jim Kent's BLAT program.

--	Display conventions: This track uses the display conventions for mRNA tracks.
--	Track details: Clicking on an entry in full display mode will show position information and provide links to genomic alignments of the Fosmid ends.
--	Table details: To view a text version of the data set, select the fosEndPairs positional table in the Table Browser. To view the table definition, click here.

Fugu Blat
This track displays translated BLAT alignments of Takifugu rubripes whole genome shotgun reads against the currently selected genome assembly. The alignments were done with BLAT in translated protein mode requiring 2 nearby 4-mer matches to trigger a detailed alignment. The human genome was masked with RepeatMasker and Tandem Repeats Finder before running BLAT. The fugu sequence used in this track is version 3.0, provided by the DOE Joint Genome Institute (JGI).

--	Display conventions: This track uses the display conventions for BLAT tracks.
--	Track details: Clicking on an entry in full display mode brings up links to the DNA sequence and the alignment.
--	Table details: To view a text version of the data set, select the blatFugu positional table in the Table Browser. To view the table definition, click here.

Fugu Chain
This track shows Fugu genomic alignment to the selected genome using blastz and axtChain.

--	Display conventions: This track uses the display conventions for chain tracks.
--	Track details: Clicking on an item in full display mode shows position information in the Fugu and the selected genome, the chain ID and score, and provides links to view details of parts of the chain or to open the Fugu browser to the corresponding position.
--	Table details: To view a text version of the data set, select the chainFrX positional table in the Table Browser, where X is the assembly version in which you're interested. To view the table definition, click here.

Fugu Ecores
This track shows Fugu evolutionary conserved regions (ecores) computed against the selected assembly genome by the Exofish program at Genoscope. For information on this track, see the Human Ecores track description.

Fugu ESTs
See the description for Human ESTs.

Fugu mRNAs
See the description for Human mRNAs.

Fugu Net
This track shows the best Fugu chain for every part of the selected genome. See the Human Net track description for more information.

Gap
This track depicts gaps in the assembly. These gaps - with the exception of intractable heterochromatic gaps - are closed during the finishing process.

--	Display conventions: Gaps are represented as black boxes. If the relative order and orientation of the contigs on either side of the gap is known from mRNA, ESTs, or paired BAC end reads, it is a "bridged" gap and a white line is drawn through the black box representing the gap. The display must be sufficiently zoomed in to view these features: at a coarser scale, the gaps can appear to coalesce in the the graphic. In full display mode, the gap label indicates the type of gap (see below) and whether the gap is bridged.
	Strand misorientation errors can occur adjacent to unbridged gaps. Unbridged gaps are assigned somewhat arbitrary sequence sizes (runs of N's in genomic DNA); uncertainty is less with bridged gaps. A gap within contig fragments of a clone is typically smaller than a gap between draft clones.
--	Track details: Clicking on an item in full display mode will show the gap type, bridging information and position information about the gap. Unfinished clones may have gaps of uncertain size between fragments.
--	Table details: To view a text version of the data set, select the gap positional table in the Table Browser. To view the table definition, click here.

GC Percent
This shows the percentage of bases that are G or C in a 5-base window. High GC content is associated with gene rich areas.

--	Display conventions: This track uses the display conventions for wiggle tracks.
--	Track configuration: The track description page contains options to configure several of the graph characteristics. To read more information about each option, click the "Graph configuration help" link.
--	Track details: Clicking on one of the peaks in the track when in full display mode will show position information and provide a link to the underlying DNA sequence. In full mode in a zoomed-out display, detailed information may not be accessible for an individual feature. In this case, zoom in and try again.
--	Table details: To view a text version of the data set, select the gc5Base positional table in the Table Browser. To view the table definition, click here.

GC Samples (Zoo)
This track shows the percentage of bases that are G or C in small regions across the genome. Windows with high GC content are plotted at higher vertical positions than windows with low GC content. High GC content is associated with gene-rich areas.

--	Display conventions: This track uses the display conventions for wiggle tracks.
--	Track configuration: The track description page contains a filter that can be used to turn on the chromosome color track or to filter the display output by chromosome.
--	Track details: Clicking on one of the peaks in the track when in full display mode will show position information and provide a link to the underlying DNA sequence. In full mode in a zoomed-out display, detailed information may not be accessible for an individual feature. In this case, zoom in and try again.
--	Table details: To view a text version of the data set, select the pGC positional table in the Table Browser. To view the table definition, click here.

Gene Annotations (Zoo)
This track displays NISC-generated, curated gene annotations for each of the zoo species and human. Exon locations of known genes were determined by aligning human and/or mouse reference cDNA sequences with each species' assembled genomic sequence. Any splice-site consensus, exon structure, or protein translation errors encountered were manually inspected and corrected.

--	Display conventions: This track uses the display conventions for gene prediction tracks. As with other tracks in this category, it may be necessary to zoom in to display entries in full display mode due to the 300 line display limit.
--	Track details: Clicking on an item in full mode provides position, size, and score information, and a link to dsplay the DNA sequence associated with this feature.
--	Table details: To view a text version of the data set, select the pjt_gene positional table in the Table Browser. To view the table definition, click here.

Gene Bounds
This track shows the boundaries of genes and the direction of transcription as deduced from clustering spliced ESTs and mRNAs against the genome. When there are many spliced variants of the same gene, this track shows the variant that spans the greatest distance in the genome.

--	Display conventions: This track uses the display conventions for EST tracks. As with other tracks in this category, it may be necessary to zoom in to display entries in full display mode due to the 300 line display limit.
--	Track details: Clicking on an item in full mode provides position, size, and score information, and a link to dsplay the DNA sequence associated with this feature.
--	Table details: To view a text version of the data set, select the rnaCluster positional table in the Table Browser. To view the table definition, click here.

Geneid Gene Predictions
This track shows gene predictions from the geneid program, which is being developed at the Grup de Recerca en Informatica Biomedica at IMIM in Barcelona. Geneid uses information from sequence signals involved in genes specification, as well as coding coding statistics, to define exons and genes.

--	Display conventions: This track uses the display conventions for gene predictions tracks.
--	Track details: Clicking on an entry in full display mode brings up basic track information, plus links to the translated protein, predicted mRNA, and genomic sequences.
--	Table details: To view a text version of the data set, select the geneid positional table in the Table Browser. To view the table definition, click here.

GenMapDB Clones
This track shows BAC clones from the GenMapDB database placed on the draft sequence using BAC end sequence information and confirmed using STS markers by Vivian Cheung's lab at the Department of Pediatrics, University of Pennsylvania.

--	Display conventions: The clone positions are shown in black.
--	Track details: Clicking on an entry in full display mode brings up basic position information and additional information about the clones and STS markers.
--	Table details: To view a text version of the data set, select the genMapDb positional table in the Table Browser. To view the table definition, click here.

Genoscope GAZE (Tetraodon)
This track shows Genoscope gene model annotations from the GAZE program written by Kevin Howe. These annotaions were computed using GAZE with a i custom-designed gene model. GAZE integrates information from Geneid, Genscan, Exofish (Human, Mouse and Fugu), Genewise (Human and Mouse) and Tetraodon cDNAs.

--	Display conventions: This track uses the display conventions for gene prediction tracks.
--	Track configuration: The track description page contains a control that can be used to turn on codon coloring.
--	Track details: Clicking on a track feature in full display mode shows position information and provides links to the translated protein, predicted mRNA, and genome sequences.
--	Table details: To view a text version of the data set, select the gaze positional table in the Table Browser. To view the table definition, click here.

Genscan Genes
This track shows gene predictions from GenScan. These predictions are based on transcriptional, translational, and donor and acceptor splicing signals, plus length and compositional distributions of exons, introns and intergenic regions. The program does not use similarity to known proteins like GenomeScan. For a description of the Genscan program and the model that underlies it, refer to Burge, C. and Karlin, S. (1997) Prediction of complete gene structures in human genomic DNA. J. Mol. Biol. 268(1):78-94.

--	Display conventions: This track uses the display conventions for gene predictions tracks.
--	Track details: Clicking on an entry in full display mode will show basic track information, plus links to the translated protein, predicted mRNA, and genomic sequences.
--	Table details: To view a text version of the data set, select the genscan positional table in the Table Browser. To view the table definition, click here.

Genscan Genes (Zoo)
This track shows gene predictions from the GenScan program written by Chris Burge.

--	Display conventions: This track uses the display conventions for gene predictions tracks.
--	Track details: Clicking on an entry in full display mode shows basic track information and provides a link to view the underlying genomic sequence.
--	Table details: To view a text version of the data set, select the pjt_genscan positional table in the Table Browser. To view the table definition, click here.

GNF Atlas 2
This track shows expression data from the GNF (The Genomics Institute of the Novartis Research Foundation) Gene Expression Atlas 2. The data contains 2 replicates each of 61 mouse tissues and 79 human tissues run over Affymetrix microarrays. For more information about the experiments, refer to the description page for this track.

--	Display conventions: This track uses display conventions similar to those for mRNA tracks.
--	Track details: In dense or packed display mode, the track shows averages of related tissues. In full display mode, all tissues are displayed. Click on an individual tissue entry to show a gene expression map for all tissues in the experiment.
--	Table details: To view a text version of the data set, select the gnfAtlas2 positional table in the Table Browser. To view the table definition, click here.

GNF Ratio
This track shows expression data from GNF (The Genomics Institute of the Novartis Research Foundation) using Affymetrix GeneChips. For more information about the experiments, refer to the description page for this track.

--	Display conventions: In dense display mode, the track color denotes the average signal over all experiments on a log base 2 scale. Lighter colors correspond to lower signals and darker colors correspond to higher signals. In full display mode, the color of each item represents the log base 2 ratio of the signal of that particular experiment to the median signal of all experiments for that probe.
--	Track configuration: The track description page contains options to change the display mode, group the displayed results, and change the display colors.
--	Table details: To view a text version of the data set, select the affyRatio positional table in the Table Browser. To view the table definition, click here.

GNF U74A
This track shows expression data from GNF using the Affymetrix U74A chip.

--	Display conventions: This track follows display conventions similar to mRNA tracks.
--	Track details: In dense or packed display mode, the track shows averages of related tissues. In full display mode, all tissues are displayed. Click on an individual tissue entry to show a gene expression map for all tissues in the experiment.
--	Table details: To view a text version of the data set, select the affyGnfU74A positional table in the Table Browser. To view the table definition, click here.

GNF U74B
This track shows expression data from GNF using the Affymetrix U74B chip.

--	Display conventions: This track follows display conventions similar to mRNA tracks.
--	Track details: In dense or packed display mode, the track shows averages of related tissues. In full display mode, all tissues are displayed. Click on an individual tissue entry to show a gene expression map for all tissues in the experiment.
--	Table details: To view a text version of the data set, select the affyGnfU74B positional table in the Table Browser. To view the table definition, click here.

GNF U74C
This track shows expression data from GNF using the Affymetrix U74C chip.

--	Display conventions: This track follows display conventions similar to mRNA tracks.
--	Track details: In dense or packed display mode, the track shows averages of related tissues. In full display mode, all tissues are displayed. Click on an individual tissue entry to show a gene expression map for all tissues in the experiment.
--	Table details: To view a text version of the data set, select the affyGnfU74C positional table in the Table Browser. To view the table definition, click here.

Haplotype Blocks (chr21)
See the description for Perlegen.

Haplotype Blocks (chr22)
This track shows haplotype blocks on Chromosome 22 from The University of Oxford and The Wellcome Trust Sanger Institute, as described in Dawson E. et. al. (2002), "A first-generation linkage disequilibrium map of human chromosome 22", Nature 418:544-8.

--	Display conventions: The location of each haplotype block is represented by a blue horizontal line with tall vertical blue bars at the first and last SNPs of the block. Blocks are displayed as starting at the first SNP and ending at the last SNP of the block. Individual SNPs are denoted by smaller black vertical bars. At multi-megabase resolution in dense display mode, clusters of tall blue bars may indicate hotspots for recombination.
--	Track details: Clicking on an entry in full display mode will show basic position information, SNP information for the block, and a link to sequence information for the feature.
--	Table details: To view a text version of the data set, select the haplotype positional table in the Table Browser. To view the table definition, click here.

H-Inv
This track shows alignments of full-length cDNAs used as the basis of the H-Invitational Gene Database (HInv-DB). Entries in this track include gene structures, functions, functional domains, metabolic pathways, and many other entities.

--	Display conventions: This track uses the display conventions for mRNA tracks.
--	Track details: Clicking on an entry in full display mode provides gene ID, cluster ID, and cDNA accession information and a link to sequence information for the feature.
--	Table details: To view a text version of the data set, select the HInvGeneMrna positional table in the Table Browser. To view the table definition, click here.

HOX Genes (Tetraodon chr2, 8, 9, 17, 21, and un_random only)
This track shows HOX genes annotated using information on sequence similarity between Tetraodon vs. human, mouse and zebrafish HOX protein and nucleotide sequences.

--	Display conventions: This track uses the display conventions for gene prediction tracks.
--	Track details: Clicking on an entry in full display mode provides position, size, and CDS information, and links to the related translated protein, predicted mRNA, and genomic sequences.
--	Table details: To view a text version of the data set, select the hoxGenes positional table in the Table Browser. To view the table definition, click here.

Human Best
This track displays best-in-genome alignments of the specified human draft assembly to the selected genome baed on the associated alignment net, i.e. the best chain for every part of the human genome. See the track description page for the Human Net track for more information about the methods used to generate this track.

--	Display conventions: This track uses the display conventions for cross-species synteny tracks.
--	Track details: Clicking on an entry in full display mode will show position information for the human alignment and the selected genome, alignment details, and a link to a detailed view of parts of the alignment.
--	Table details: To view a text version of the data set, select the axtNetHgX positional table in the Table Browser, where X is the assembly version in which you're interested. To view the table definition, click here.

Human Blat
This track displays translated BLAT alignments of the human genome vs. the mouse genome. The alignments were done with BLAT in translated protein mode using the parameters -q=dnax -t=dnax and otherwise the default settings. Both genomes were masked with RepeatMasker and Tandem Repeats Finder before running BLAT. Places where more than 250 alignments occurred over the same place were filtered out. Beware of alignments of greater than 97% identity: these may reflect mouse contamination in the human genome or human contamination in the mouse genome.

--	Display conventions: This track uses the display conventions for a BLAT alignment track.
--	Track details: Clicking on an entry in full display mode will show basic track information and a link to sequence information for the alignment.
--	Table details: To view a text version of the data set, select the blatHuman positional table in the Table Browser. To view the table definition, click here.

Human Chain
This track shows human genomic alignment to the selected genome using blastz and axtChain.

--	Display conventions: This track uses the display conventions for chain tracks.
--	Track details: Clicking on an item in full display mode shows position information in the mouse and the selected genome, the chain ID and score, and provides links to view details of parts of the chain or to open the mouse browser to the corresponding position.
--	Table details: To view a text version of the data set, select the chainX positional table in the Table Browser, where X is the assembly version in which you're interested, e.g. Hg16. To view the table definition, click here.

Human Cons
This track displays the conservation between the mouse and human genomes for 50bp windows in the mouse genome that have at least 15bp aligned to human. The score for a window reflects the probability that the level of observed conservation in that 50bp region would occur by chance under neutral evolution. It is given on a logarithmic scale, and thus it is called the "L-score". An L-score of 1 means there is a 1/10 probability that the observed conservation level would occur by chance, an L-score of 2 means a 1/100 probability, an L-score of 3 means a 1/1000 probability, etc. The L-scores display as "mountain ranges".

--	Display conventions: This track uses the display conventions for wiggle tracks.
--	Track configuration: The track description page contains options to configure several of the graph characteristics. To read more information about each option, click the "Graph configuration help" link.
--	Track details: Clicking on one of the peaks in the track when in full display mode will show human genome position information for the window, as well as position information for the corresponding region in the human genome. The details page provides links to the underlying sequence for the alignment and to the sequence underlying the individual alignment windows. In full mode in a zoomed-out display, detailed information may not be accessible for an individual feature. In this case, zoom in and try again.
--	Table details: To view a text version of the data set, select the musHumL positional table in the Table Browser. To view the table definition, click here.

Human Deletions
This track displays regions of the chimp assembly that are deleted in the human assembly. Only regions of between 80 and 12000 bases are included. The name of each deletion is a unique pointer to that deletion followed by an underscore and then its length. A similar track, showing chimp deletions in the human assembly, appears in the human Genome Browser.

--	Display conventions: Deletions are indicated by thin vertical lines.
--	Track details: Clicking on a deletion in full display mode provides the item name, position, genomic size, and a link to the DNA underlying the feature.
--	Table details: To view a text version of the data set, select the humanDels positional table in the Table Browser. To view the table definition, click here.

Human Ecores
This track shows human evolutionary conserved regions (ecores) computed against the selected assembly by the Exofish program at Genoscope.

--	Display conventions: This track uses display conventions similar to mRNA tracks. Each singleton block corresponds to an ecore. Blocks connected by a line correspond to an "ecotig", a set of colinear ecores in a syntenic region.
--	Track details: Clicking on an entry in full display mode will show positional information, a link to the Exofish browser, and a link to display the DNA sequence.
--	Table details: To view a text version of the data set, select the ecores positional table in the Table Browser, where X is the assembly version in which you're interested (e.g. hg16). To view the table definition, click here.

Human ESTs
This track shows alignments between Expressed Sequence Tags (ESTs) - spliced and unspliced - in GenBank and the genome. ESTs are single read (typically approximately 500 base) sequences that usually represent fragments of transcribed genes. To view only spliced ESTs, see the Spliced EST track. This track was generated by aligning human ESTs from GenBank against the genome using the BLAT program. Note that the maximum intron length allowed by BLAT is 500,000 bases, which may eliminate some ESTs with very long introns that might otherwise align. When a single EST aligns in multiple places, the alignment having the highest base identity is found. Only alignments that have a base identity level within 1% of the best are kept. Alignments must also have at least 93% base identity to be kept.

--	Display conventions: This track uses the display conventions for EST tracks. Hatch marks on the introns indicate the direction of transcription. In the December 2001 assembly and later, this direction is taken by looking at the splice sites. In previous assemblies, the direction of transcription was taken from the GenBank annotations, which frequently were inaccurate; these should be verified in the details page alignment on the basis of the GT-AG splice donor/acceptor rule. As with otherEST tracks, it may be necessary to zoom in to display entries in full display mode due to the 300 line display limit.
--	Track configuration: The track description page contains a filter to restrict the display to only those entries that match certain keywords and to change the color of the selected entries.
--	Track details: Clicking on an individual EST entry will show basic track information, the accession number, GenBank highlights, and links to EST/Genomic Alignments.
--	Table details: To view a text version of the data set, select the all_est positional table in the Table Browser. To view the table definition, click here.

Human mRNAs
This track shows alignments between mRNAs from the current assembly in GenBank and the genome. The mRNAs are aligned against the genome using the BLAT program. When a single mRNA aligns in multiple places, the alignment having the highest base identity is found. Only alignments that have a base identity level within 1% of the best are kept. Alignments must also have at least 95% base identity to be kept.

--	Display conventions: This track follows the display conventions for mRNA tracks.
--	Track configuration: The track description page contains a filter to restrict the display to only those entries that match certain keywords and to change the color of the selected entries.
--	Track details: Clicking on an entry in full display mode will show a summary of the GenBank entry on that mRNA, convenient hyperlinks to major databases, and base-by-base mRNA/genomic alignments.
--	Table details: To view a text version of the data set, select the all_mrna positional table in the Table Browser. To view the table definition, click here.

Human Net
This track shows the best human chain for every part of the selected genome.

--	Display conventions: This track uses the display conventions for net tracks.
--	Track details: In full display mode, clicking on a box shows details information about the chain as a whole, while clicking on a line shows information about the gap. The detailed information is useful in determining the cause of the gap or, for lower level chains, the genomic rearrangement.
--	Table details: To view a text version of the data set, select the netX positional table in the Table Browser, where X is the assembly version in which you're interested, e.g. Hg16. To view the table definition, click here.

Human Proteins
This track shows tBLASTn alignments of the peptides from the predicted and known genes indentified in the specified Known Genes track.

--	Display conventions: This track follows the display conventions for mRNA tracks.
--	Track configuration: The track description page contains options to configure the information shown in the track element labels.
--	Track details: Clicking on an entry in full display mode will show position information, external links to human mRNA and SwissPort information, and links to the alignment and peptide sequences.
--	Table details: To view a text version of the data set, select the blastHg16KG positional table in the Table Browser. To view the table definition, click here.

Human Synteny
This track shows syntenous (corresponding) regions between mouse and human chromosomes. The track was created by passing a 100k non-overlapping window over the genome and using the blastz best in human genome alignments to look for high-scoring regions where at least 40% of the bases aligned with the same region in mouse. 100k segments were joined together if they agreed in direction and were within 500kb of each other in the mouse genome and within 4mb of each other in the human. Gaps were joined between syntenic anchors if the bases between two flanking regions agreed with synteny (direction and human location). The syntenic block was extended to include these areas.

--	Display conventions: This track uses the display conventions for synteny tracks.
--	Track details: Clicking on an item in full display mode shows details of the mouse-human correspondence and provides a link to the genomic sequence for this feature.
--	Table details: To view a text version of the data set, select the syntenyHuman positional table in the Table Browser. To view the table definition, click here.

Human Tight
This track displays Blastz alignments of the human assembly to the current genome, filtered by axtBest and subsetAxt with very stringent constraints. See the track's description page for more details.

--	Display conventions: This track uses the display conventions for cross-species synteny tracks.
--	Track details: Clicking on an entry in full display mode will show position information for the human and the current genome, alignment details, and a link to a detailed view of parts of the alignment.
--	Track configuration: The track description page contains a filter that can be used to turn on the chromosome color track or to filter the display output by chromosome.
--	Table details: To view a text version of the data set, select the blastzTightHg positional table in the Table Browser, where X is the number of the assembly. To view the table definition, click here.

JGI Genes (C. intestinalis)
This track contains alignments of predicted transcripts from the DOE Joint Genome Institute (JGI) to the C. intestinalis genome.

--	Display conventions: This track uses the display conventions for gene predictions tracks.
--	Track details: Clicking on an entry in full display mode brings up basic track information, plus links to the translated protein, predicted mRNA, and genomic sequences.
--	Table details: To view a text version of the data set, select the jgiGene positional table in the Table Browser. To view the table definition, click here.

Known Genes
The Known Genes track shows known protein coding genes based on proteins from SWISS-PROT, TrEMBL, and TrEMBL-NEW and their corresponding mRNAs from GenBank. Features are colored according to origin and review status:

• Black: Feature has a corresponding entry in the Protein Data Bank (PDB).
• Dark blue: Feature has a corresponding protein in SWISS-PROT or a corresponding NCBI Reference Sequence mRNA with a "Reviewed" status.
• Lighter blue: Feature has a corresponding NCBI Reference Sequence mRNA with "Provisional" status.
• Lightest blue: All other features.

Map Contigs
This track shows the locations of contigs of clones on the physical map. In assembly versions prior to the August 6 2001 assembly, this track was based on the Washington University accession map, which in turn was based on a fingerprint contig (FPC) map described in 'A physical map of the human genome' in Nature volume 409 pages 934-941. Starting with the August 6 2001 assembly, this track is based on tiling path fingerprint (TPF) maps curated by the sequencing centers responsible for each chromosome. The TPF maps are merged with the FPC map, favoring the TPF map where conflicts occur. This step increases the clone coverage substantially over that in the TPF maps. The clone contigs in this merged map are shown in this track.

--	Display conventions: The clone contigs are represented by blocks that indicate their location on the assembly sequence.
--	Track details: Clicking on an item in full display mode will show a brief description of the extent and number of clones in contig, and the DNA sequence.
--	Table details: To view a text version of the data set, select the ctgPos positional table in the Table Browser. To view the table definition, click here.

Mapped Human (X. tropicalis)
This track contains tBLASTn alignments of the peptides from the predicted and known genes identified in the specified version of the Known Genes track.

--	Display conventions: This track follows the display conventions for BLAT tracks.
--	Track details: Clicking on an item in full display mode shows positional information, related mRNA and SwissProt links, the protein length, and links to the alignment an peptide sequences.
--	Table details: To view a text version of the data set, select the blastHg17KG positional table in the Table Browser. To view the table definition, click here.

MCS Binomial (Zoo)
This track shows Multi-Species Conserved Sequences (MCSs) defined using a conservation score threshold from the binomial-based method that selects the top 5% most conserved sequence.

--	Display conventions: Sequence positions are depicted by blocks.
--	Track details: Clicking on an item in full display mode shows position and size information, and provides a link to the underlying DNA sequence.
--	Table details: To view a text version of the data set, select the mcs_b positional table in the Table Browser. To view the table definition, click here.

MCS Inter (Zoo)
This track shows Multi-Species Conserved Sequences (MCSs) found by intersecting the sequences generated using the binomial-based and parsimony p-value-based methods (see the MCS Binomial and MCS ParsPVal track descriptions).

--	Display conventions: Sequence positions are depicted by blocks.
--	Track details: Clicking on an item in full display mode shows position and size information, and provides a link to the underlying DNA sequence.
--	Table details: To view a text version of the data set, select the intersectingMCS positional table in the Table Browser. To view the table definition, click here.

MCS InterMerged (Zoo)
Same as MCS Inter, but regions less than 10 bp apart have been merged into one region.

--	Display conventions: Sequence positions are depicted by blocks.
--	Track details: Clicking on an item in full display mode shows position and size information, and provides a link to the underlying DNA sequence.
--	Table details: To view a text version of the data set, select the intersectingMergedMCS positional table in the Table Browser. To view the table definition, click here.

MCS ParsPVal (Zoo)
This track shows Multi-Species Conserved Sequences (MCSs) defined using a conservation score threshold from the parsimony p-value method that selects the top 5% most conserved sequence.

--	Display conventions: Sequence positions are depicted by blocks.
--	Track details: Clicking on an item in full display mode shows position and size information, and provides a link to the underlying DNA sequence.
--	Table details: To view a text version of the data set, select the mcs_p positional table in the Table Browser. To view the table definition, click here.

MGC Genes
This track displays alignments between Mammalian Gene Collection (MGC) human mRNAs with full-length ORFs and the human genome.

--	Display conventions: This track uses the display conventions for gene predictions tracks.
--	Track details: Clicking on an entry in full display mode will show basic track information and links to the mRNA, genomic, and comparative sequences.
--	Track configuration: The track description page offers configuration options that can be used to turn on codon coloring for the track. Click the "Codon coloring help" link on the page for more information about this feature.
--	Table details: To view a text version of the data set, select the mgcGenes positional table in the Table Browser. To view the table definition, click here.

Microsatellites
This track contains all perfect microsatellite repeats with between 2 and 10 bp repeat units and 10 or more perfect copies. Over 90% of the items will be multi-allelic polymorphisms. This track was created by using three programs: Tandyman, display_VNTR and Primeleftright. See the track description page for more information.

--	Display conventions: Microsatellite locations are indicated by thin grey vertical lines.
--	Track details: Clicking on an item in full display mode shows position information, details about the repeat, and a link to the DNA sequence associated with the feature.
--	Table details: To view a text version of the data set, select the vntr positional table in the Table Browser. To view the table definition, click here.

miRNA
This track shows microRNAs from the miRNA Registry at the Wellcome Trust Sanger Institute.

--	Display conventions: Mature miRNAs (miRs) are represented by thick lines; the predicted stem-loop portions of the primary transcripts are indicated by thinner lines. miRNAs in the sense orientation are shown in black; those in the reverse orientation are colored grey. When a single precursor produces two mature miRs from its 5' and 3' parts, it is displayed twice with the two different positions of the mature miR.
--	Track details: Clicking in full mode displays positional information and a link to item's entry in the miRNA registry.
--	Table details: To view a text version of the data set, select the miRNA positional table in the Table Browser. To view the table definition, click here.

Most Conserved
This track shows predictions of conserved elements produced by the phastCons program. Predictions are based on a phylogenetic hidden Markov model (phylo-HMM), a type of probabilistic model that describes both the process of DNA substitution at each site in a genome and the way this process changes from one site to the next. For more information on the methods used to produce this track, see the track's description page.

--	Display conventions: Rectangular blocks indicate the positions of conserved elements.
--	Track details: Clicking on an entry in full display mode will show position information and a list of the top-scoring elements in the window.
--	Table details: To view a text version of the data set, select the phastConsElements positional table from the Table Browser. To view the table definition, click here.

Mouse Blat
This track displays alignments of mouse genome to human. The mouse genomic DNA is from the Arachne assembly of mouse whole genome shotgun reads available at the Trace Repository. The alignments were done with BLAT in translated protein mode requiring 2 nearby 4-mer matches to trigger a detailed alignment. The human genome was masked with RepeatMasker and Tandem Repeats Finder prior to running BLAT. Regions with more than 300 aligned reads were assumed novel repeat elements and filtered out. Alignments of greater than 97% identity may represent mouse contamination of human or vice versa.

--	Display conventions: This track follows the display conventions for BLAT tracks.
--	Track details: Clicking on an item will show details on mouse sequence fragment and alignment details.
--	Table details: To view a text version of the data set, select the blatMouse positional table in the Table Browser. To view the table definition, click here.

Mouse Chain
This track shows mouse genomic alignment to the selected genome using blastz and axtChain. See the Human Chain track description for more information.

Mouse Cons
This track displays the conservation between the human and mouse genomes for 50bp windows in the human genome that have at least 15bp aligned to mouse. The score for a window reflects the probability that the level of observed conservation in that 50bp region would occur by chance under neutral evolution. It is given on a logarithmic scale, and thus it is called the "L-score". An L-score of 1 means there is a 1/10 probability that the observed conservation level would occur by chance, an L-score of 2 means a 1/100 probability, an L-score of 3 means a 1/1000 probability, etc. The L-scores display as "mountain ranges".

--	Display conventions: This track uses the display conventions for wiggle tracks.
--	Track configuration: The track description page contains options to configure several of the graph characteristics. To read more information about each option, click the "Graph configuration help" link.
--	Track details: Clicking on one of the peaks in the track when in full display mode will show human genome position information for the window, as well as position information for the corresponding region in the mouse genome. The details page provides links to the underlying sequence for the alignment and to the sequence underlying the individual alignment windows. In full mode in a zoomed-out display, detailed information may not be accessible for an individual feature. In this case, zoom in and try again.
--	Table details: To view a text version of the data set, select the humMusL positional table in the Table Browser. To view the table definition, click here.

Mouse Ecores
This track shows Mouse evolutionary conserved regions (ecores) computed against the selected assembly genome by the Exofish program at Genoscope. For information on this track, see the Human Ecores track description.

Mouse ESTs
This track shows alignments between mouse Expressed Sequence Tags (ESTs) - spliced and unspliced - in GenBank and the genome. This track was generated by aligning mouse ESTs from GenBank against the genome using the BLAT program. Note that the maximum intron length allowed by BLAT is 500,000 bases, which may eliminate some ESTs with very long introns that might otherwise align. When a single EST aligns in multiple places, the alignment having the highest base identity is found. Only alignments that have a base identity level within 1% of the best are kept. Alignments must also have at least 93% base identity to be kept.

--	Display conventions: This track uses the display conventions for EST tracks. As with other EST tracks, it may be necessary to zoom in to display entries in full display mode due to the 300 line display limit.
--	Track details: Clicking on an individual EST entry will show basic track information, the accession number, GenBank highlights, and links to EST/Genomic Alignments.
--	Table details: To view a text version of the data set, select the all_est positional table in the Table Browser. To view the table definition, click here.

Mouse mRNAs
See the description for Human mRNAs.

Mouse Net
This track shows the best mouse chain for every part of the selected genome. See the Human Net track description for more information.

Mouse Synteny (hg13+)
This track shows syntenous (corresponding) regions between human and mouse chromosomes. The track was created by passing a 100k non-overlapping window over the genome and using the blastz best in mouse genome alignments to look for high-scoring regions where at least 40% of the bases aligned with the same region in mouse. 100k segments were joined together if they agreed in direction and were within 500kb of each other in the human genome and within 4mb of each other in the mouse. Gaps were joined between syntenic anchors if the bases between two flanking regions agreed with synteny (direction and mouse location). The syntenic block was extended to include these areas.

--	Display conventions: This track uses the display conventions for synteny tracks.
--	Track details: Clicking on an item in full display mode shows details of the mouse-human correspondence and provides a link to the genomic sequence for this feature.
--	Table details: To view a text version of the data set, select the syntenyMouse positional table in the Table Browser. To view the table definition, click here.

Mouse Synteny (hg12 only)
This track shows orthologous (syntenic) regions between mouse and human chromosomes based on data from Michael Kamal at the Whitehead Institute. Track details: Clicking on an item in full display mode will show details of the mouse-human correspondence, as well links to genomic dotplots, additional information, and an alternative synteny map based on orthologous genes.

--	Display conventions: This track uses the display conventions for synteny tracks.
--	Table details: To view a text version of the data set, select the mouseSynWhd positional table in the Table Browser. To view the table definition, click here.

Multiz Yeast
This track displays multiz multiple alignments of seven species of the genus Saccharomyces. The graphic display shows the alignment projected onto S. cerevisiae.

--	Display conventions: In full display mode, the track displays pairwise alignments of several species aligned to the S. cerevisiae genome. The pairwise alignments are displayed in standard UCSC browser "dense" mode using a grey-scale density gradient. When zoomed-in to the base-display level, the track shows the base composition of each alignment. The numbers and symbols on the "hidden gap" line indicate the lengths of gaps in the S. cerevisiae sequence at those alignment positions. If the gap size is greater than 9, the "+" symbol is displayed. The track must be zoomed-in to 30,000 or fewer bases to access detailed information about the alignments at a specific position.
--	Track details: Clicking on an entry in full display mode will show detailed alignment information for each of the organisms.
--	Table details: To view a text version of the data set, select the multizYeast positional table in the Table Browser. To view the table definition, click here.

NIA Genes
This track displays alignments of the National Institute on Aging (NIA) Mouse Gene Index (Version 3) against the mouse genome.

--	Display conventions: This track uses the display conventions for Blat alignment tracks.
--	Track details: Clicking on an individual track item in full mode displays a page with alignment details and a link to the corresponding NIA Mouse Gene Index entry.
--	Table details: To view a text version of the data set, select the NIAGene positional table in the Table Browser. To view the table definition, click here.

NCI60
This track displays cDNA expression data for a micro-array of 8,000 genes for 60 cell lines used in an NCI cancer drug screen. Track details: Clicking on an individual track item in full mode opens a rich details page. The exon probe and experiment selected are highlighted in blue under item name.

--	Display conventions: To understand the track, experiment with it set to full mode but other tracks (except known genes) hidden, while reading its filter page. Each column of colored boxes represents variation in transcript levels for a given cDNA across array experiments; each row represents the measured transcript levels for all genes in a single sample. The saturation of a color corresponds to the magnitude of transcript variation. Black indicates an undetectable change in expression; gray shows missing data.
--	Track configuration: The track description page contains a filter to limit the tissue types displayed and change the color scheme of the display.
--	Table details: To view a text version of the data set, select the nci60 positional table in the Table Browser. To view the table definition, click here.

Non-A. gambiae mRNAs
See the description for Non-Human mRNAs.

Non-A. mel. mRNAs
mRNAs of organisms other than A. mellifera. See the description for Non-Human mRNAs.

Non-Chicken mRNAs
See the description for Non-Human mRNAs.

Non-Chicken RefSeq
This track shows known protein-coding genes from organisms other than chicken, taken from the mRNA reference sequences collection (RefSeq) compiled at NCBI. See the Non-Dog RefSeq track for more information.

Non-Chimp ESTs
See the description for Non-Human ESTs.

Non-Chimp mRNAs
See the description for Non-Human mRNAs.

Non-C. intestinalis mRNAs
See the description for Non-Human mRNAs.

Non-Ciona mRNAs
See the description for Non-Human mRNAs.

Non-Ciona RefSeq
This track shows known protein-coding genes from organisms other than C. intestinalis, taken from the mRNA reference sequences collection (RefSeq) compiled at NCBI. See the Non-Dog RefSeq track for more information.

Non-Dog RefSeq
This track shows known protein-coding genes from organisms other than dog, taken from the mRNA reference sequences collection (RefSeq) compiled at NCBI.

--	Display conventions: This track uses the display conventions for gene predictions tracks.
--	Track details: Clicking on an entry in full display provides links to the corresponding protein, mRNA, and genomic sequences, and related links to external databases.
--	Track configuration: The track description page contains configuration options to change the feature label to display the gene name (default), the accession name, both the gene and accession names, or no label at all.
--	Table details: To view a text version of the data set, select the xenoRefGene positional table in the Table Browser. To view the table definition, click here.

Non-D. anan. mRNAs
mRNAs of organisms other than D. ananassae. See the description for Non-Human mRNAs.

Non-D. anan. RefSeq
This track shows known protein-coding genes from organisms other than D. ananassae, taken from the mRNA reference sequences collection (RefSeq) compiled at NCBI. See the description for Non-Human mRNAs.

Non-D. melanogaster mRNAs
See the description for Non-Human mRNAs.

Non-D. moj. mRNAs
mRNAs of organisms other than D. mojavensis. See the description for Non-Human mRNAs.

Non-D. moj. RefSeq
This track shows known protein-coding genes from organisms other than D. mojavensis, taken from the mRNA reference sequences collection (RefSeq) compiled at NCBI. See the description for Non-Human mRNAs.

Non-D. pseudo. mRNAs
mRNAs of organisms other than D. pseudoobscura. See the description for Non-Human mRNAs.

Non-D. pseudo. RefSeq
This track shows known protein-coding genes from organisms other than D. pseudoobscura, taken from the mRNA reference sequences collection (RefSeq) compiled at NCBI. See the description for Non-Human mRNAs.

Non-D. vir. mRNAs
mRNAs of organisms other than D. virilis. See the description for Non-Human mRNAs.

Non-D. vir. RefSeq
This track shows known protein-coding genes from organisms other than D. virilis, taken from the mRNA reference sequences collection (RefSeq) compiled at NCBI. See the description for Non-Human mRNAs.

Non-D. yakuba mRNAs
See the description for Non-Human mRNAs.

Non-Fugu mRNAs
See the description for Non-Human mRNAs.

Non-Human ESTs
This track displays translated BLAT alignments of non-human vertebrate ESTs from GenBank. The alignments were passed through a piecewise near-best-in-genome filter. In cases where ESTs align to multiple places in the genome, only the near-best are retained. Matches help validate human exon identification.

--	Display conventions: This track uses the display conventions for EST tracks. As with other EST tracks, it may be necessary to zoom in to display entries in full display mode due to the 300 line display limit.
--	Track details: Clicking on an item in full display will show a summary of the GenBank entry, a hyperlink to the full record, PubMed links by gene name, product, and author, and mRNA/genomic alignment information.
--	Table details: To view a text version of the data set, select the xenoEst positional table in the Table Browser. To view the table definition, click here.

Non-Human mRNAs
This track displays translated BLAT alignments of vertebrate and invertebrate mRNA (other than that from the selected genome) from GenBank. The alignments were passed through a near-best-in-genome filter. Some mRNAs align to multiple places but only the near-best are retained. For a distant vertebrate, alignment requires a fairly slowly evolving gene. Matches are often plausible ortholog candidates.

--	Display conventions: This track uses the display conventions for mRNA tracks.
--	Track configuration: The track description page contains a filter to restrict the display to only those entries that match certain keywords and to change the color of the selected entries.
--	Track details: Clicking on an entry in full display mode will show a summary of the GenBank entry on that mRNA, convenient hyperlinks to major databases, and base-by-base mRNA/genomic alignments.
--	Table details: To view a text version of the data set, select the xenoMrna positional table in the Table Browser. To view the table definition, click here.

Non-Mouse ESTs
See the description for Non-Human ESTs.

Non-Mouse mRNAs
See the description for Non-Human mRNAs.

Non-Opossum mRNAs
See the description for Non-Human mRNAs.

Non-Rat ESTs
See the description for Non-Human ESTs.

Non-Rat mRNAs
See the description for Non-Human mRNAs.

Non-Tetraodon mRNAs
See the description for Non-Human mRNAs.

Non-Zebrafish mRNAs
See the description for Non-Human mRNAs.

Opossum Chain
This track shows opossum genomic alignments to the selected genome using blastz and axtChain. See the Human Chain track description for more information.

Opossum mRNAs
See the description for Human mRNAs.

Opossum Net
This track shows the best opossum chain for every part of the selected genome. See the Human Net track description for more information.

Overlap SNPs (older archived versions only)
This track shows single nucleotide polymorphisms found on overlapping contigs. Overlap SNPs are useful markers in mapping genes and diseases. This data was provided by the SNP Consortium.

--	Display conventions: SNP locations are indicated by thin grey vertical lines.
--	Track details: Clicking in full mode brings up a location description and dbSNP link.
--	Table details: To view a text version of the data set, select the snpNih positional table in the Table Browser. To view the table definition, click here.

Parsimony P-Values (Zoo)
This track displays the level of conservation of Zoo sequences at any given position. More precisely, it computes the p-value of observing a certain parsimony score for a given column of the multiple alignment under the null model of neutral evolution.

--	Display conventions: This track uses the display conventions for wiggle tracks.
--	Track configuration: The track description page contains options to configure several of the graph characteristics. To read more information about each option, click the "Graph configuration help" link.
--	Track details: Clicking on one of the peaks in the track when in full display mode will show genome position information for the window and a link to the underlying DNA sequence. In full mode in a zoomed-out display, detailed information may not be accessible for an individual feature. In this case, zoom in and try again.
--	Table details: To view a text version of the data set, select the parsPValues positional table in the Table Browser. To view the table definition, click here.

Perlegen (chr21 only)
This track shows haplotype blocks derived from common single nucleotide polymorphisms (SNPs) on Chromosome 21 by Perlegen Sciences, as described in Patil N et. al. (2001), "Blocks of Limited Haplotype Diversity Revealed by High-Resolution Scanning", Science 294:1719-1723. General information on the blocks is available from Perlegen's Chromosome 21 Haplotype Browser.

--	Display conventions: The location of each haplotype block is represented by a blue horizontal line with tall vertical blue bars at the first and last SNPs of the block. Blocks are displayed as starting at the first SNP and ending at the last SNP of the block. This is slightly different from the representation on the Perlegen web site in which blocks are stretched until they abut each other. The shade of the blue indicates the minimum number of SNPs required to discriminate between haplotype patterns that account for at least 80% of genotyped chromosomes. Darker colors indicate fewer SNPs are necessary. Individual SNPs are denoted by smaller black vertical bars. At multi-megabase resolution in dense display mode, clusters of tall blue bars may indicate hotspots for recombination.
--	Track details: Clicking on an entry in full display mode will show basic position information, SNP information for the block, and a link to sequence information for the feature. To view additional information on a particular block, click on Outside Link on the item's details page.
--	Table details: To view a text version of the data set, select the perlegen positional table in the Table Browser. To view the table definition, click here.

QTL
This track shows approximate positions of quantititive trait loci (QTL) based on reported peak LOD scores taken from Jackson Lab's Mouse Genome Informatics (MGI) Database.

--	Display conventions: QTL locations are indicated by thin vertical bars.
--	Track details: Clicking on an item in full mode provides a link to the MGI record for the selected QTL, information about the QTL, and position information.
--	Table details: To view a text version of the data set, select the jaxQTL positional table in the Table Browser. To view the table definition, click here.

Quality Scores
This track shows the sequencing quality score (between 0 and 100) of each base in the assembly.

--	Display conventions: The height at each position of the track indicates the quality of the base. When zoomed out to a large range, the heights reflect the averaged scores. Scores of 40 or higher reflect high confidence in the sequence (with an error rate of less than 1/10,000); scores of 20 or higher reflect reasonable confidence (of working draft quality).
--	Table details: To view a text version of the data set, select the quality positional table in the Table Browser. To view the table definition, click here.

Radiation Hybrid Map (Zebrafish)
This track shows alignments between zebrafish Radiation Hybrid (RH) map sequences (consisting of ESTs and other genetic markers) and the genome.

--	Display conventions: This track uses the display conventions for EST tracks.
--	Track details: Clicking in full display mode provides a link to the genomic alignment.
--	Table details: To view a text version of the data set, select the rhMap positional table in the Table Browser. To view the table definition, click here.

Random SNPs (older archived versions only)
This track displays single nucleotide polymorphisms (SNPs)found by random sequencing. Random SNPs are useful markers in mapping genes and complex traits. Because these SNPs are detected from random reads, they are useful for evolutionary studies. This data was provided by the SNP Consortium.

--	Display conventions: SNP locations are indicated by thin grey vertical lines.
--	Track details: Clicking in full mode brings up a location description and dbSNP link.
--	Table details: To view a text version of the data set, select the snpTsc positional table in the Table Browser. To view the table definition, click here.

Rat Chain
This track shows rat genomic alignment to the selected genome using blastz and axtChain. See the Human Chain track description for more information.

Rat Ecores
This track shows rat evolutionary conserved regions (ecores) computed against the selected assembly genome by the Exofish program at Genoscope. For information on this track, see the Human Ecores track description.

Rat ESTs
See the description for the Human ESTs track.

Rat mRNAs
See the description for the Human mRNAs track.

Rat Net
This track shows the best rat chain for every part of the selected genome. See the Human Net track description for more information.

Rat Synteny
This track shows syntenous (corresponding) regions between human and rat chromosomes. The track was created by passing a 100k non-overlapping window over the genome and using the blastz best in mouse genome alignments to look for high-scoring regions where at least 40% of the bases aligned with the same region in rat. 100k segments were joined together if they agreed in direction and were within 500kb of each other in the human genome and within 4mb of each other in the rat. Gaps were joined between syntenic anchors if the bases between two flanking regions agreed with synteny (direction and rat location). The syntenic block was extended to include these areas.

--	Display conventions: This track uses the display conventions for synteny tracks.
--	Track details: Clicking on an item in full display mode shows details of the rat-human correspondence and provides a link to the genomic sequence for this feature.
--	Table details: To view a text version of the data set, select the syntenyRat positional table in the Table Browser. To view the table definition, click here.

Recomb Rate
This track shows calculated sex-averaged rates of recombination based on either the deCODE, Marshfield, or Genethon genetic maps. The deCODE map rates are displayed by default.

--	Display conventions: Each 1Mb window represents the average recombination rate of the bases contained within that window. Darker shades of gray correspond to higher recombination rates.
--	Track configuration: The track description page contains a filter to map distances (sex-averaged distance, female distance, or male distance) for the 3 different types of maps.
--	Track details: Clicking in full mode shows position information and a list of all the recombination rate values for that 1Mb window.
--	Table details: To view a text version of the data set, select the recombRate positional table in the Table Browser. To view the table definition, click here.

RefSeq Genes
The RefSeq Gene track shows known protein coding genes taken from the mRNA reference sequences collection (RefSeq) compiled at NCBI. Refseq mRNAs are aligned against the genome using the BLAT program. When a single mRNA aligns in multiple places, only the best alignments are kept. Alignments must also have at least 98% sequence identity to be kept.

--	Display conventions: This track uses the display conventions for known genes and gene predictions tracks. Non-coding RNA genes have their own track in some assemblies. The color shading indicates the level of review that the RefSeq record has undergone: predicted (light), provisional (medium), reviewed (dark).
--	Track details: Clicking on an entry in full display provides links to the corresponding protein, mRNA, and genomic sequences, and related links to outside databases.
--	Track configuration: The track description page contains configuration options to change the feature label to display the gene name (default), the accession name, both the gene and accession names, or no label at all.
--	Table details: To view a text version of the data set, select the refGene positional table in the Table Browser. To view the table definition, click here.

Reg. CHIP/CHIP
This track shows the location of the probes spotted on a slide in the chromatin immunoprecipitation/microarray hybridization (CHIP/CHIP) experiments described in Harbison, C.T. et al., Transcriptional regulatory code of a eukaryotic genome. Nature 431(7004), 99-104 (2004). See also the "Regulatory Code" track for the position of the individual motifs.

--	Display conventions: Black boxes indicate the probe locations.
--	Track details: Clicking on an entry in full display mode shows position information, as well as which transcription factors pulled down DNA that is enriched for the probe sequence, which transcription factor binding site motifs are present in the probe, and whether these motifs are conserved in related yeast species.
--	Table details: To view a text version of the data set, select the transRegCodeProbe positional table in the Table Browser. To view the table definition, click here.

Regulatory Code
This track shows putative regulatory elements in S. cerevisiae that are supported by cross-species evidence, as described in (Harbison, C.T. et al., Transcriptional regulatory code of a eukaryotic genome. Nature 431(7004), 99-104 (2004)). The authors performed a genome-wide location analysis with 203 known DNA-binding transcriptional regulators (some under multiple environmental conditions) and identified 11,000 high-confidence interactions between regulators and promoter regions. They then compiled a compendium of motifs for 102 transcriptional regulators based on a combination of their experimental results, cross-species conservation data for four species of yeast, and motifs from the literature, and finally, they mapped these motifs to the S. cerevisiae genome. This track shows positions at which these motifs matched the genome with high confidence and at which the matching sequence was well conserved across yeast species. See the "Reg. CHIP/CHIP" track for additional related information.

--	Display conventions: Regulatory elements are represented by rectangular blocks. The darker the shade of the block, the stronger the evidence supporting it.
--	Track details: Clicking on an entry in full display mode shows the sequence at that site compared to the position-specific probability matrix for the associated transcriptional regulator (shown as both a table and a graphical logo). It also indicates whether the binding site is supported by experimental (CHIP/CHIP) results and the number of other yeast species in which it is conserved.
--	Track configuration: The user can set the minimum unnormalized score criteria that data must meet to be displayed in the track.
--	Table details: To view a text version of the data set, select the tranRegCode positional table in the Table Browser. To view the table definition, click here.

Regulatory Module
This track shows predicted transcription factor binding sites based on sequence similarities upstream of coordinately expressed genes. Clicking on a particular predicted binding site brings up a page which indicates the sequence motif associated with the predicted transcription factor, and the sequence at the predicted binding site. Where known motifs have been identified by this method, they are named, otherwise they are assigned a Motif_ number.

--	Display conventions: In dense display mode, gold areas indicate the extent of the area searched for binding sites; black boxes indicate the actual binding sites. In fuller display modes, the gold areas disappear and only the binding sites are displayed.
--	Track details: Clicking on an entry in full display mode provides positional and score information about the item, and a link to display the DNA underlying the feature.
--	Track configuration: The user can set the minimum unnormalized score criteria that data must meet to be displayed in the track.
--	Table details: To view a text version of the data set, select the esRegGeneToMotif positional table in the Table Browser. To view the table definition, click here.

RepeatMasker
The track shows dispersed repeats as determined by RepeatMasker using the Repbase Update library of repetitive sequences from the Genetic Information Research Institute. These elements include SINE, LINE, LTR, DNA, simple, low complexity, micro-satellite, tRNA, and other repeat families.

--	Display conventions: Darker gray boxes indicates a more recent age (as dated by alignment to a canonical repeat). In dense mode for large chromosomal regions, the black boxes representing repeats may merge into misleading single blocks in the display. Full display mode shows 9 tracks representing the major repeat classes.
--	Table details: To view a text version of the data set, select the rmsk positional table in the Table Browser. To view the table definition, click here.

Retroposed Genes
This track shows processed mRNAs that have been inserted back into the genome after the mouse/human split. Retrogenes can be functional genes that have acquired a promoter from a neighboring gene, non-functional pseudogenes, or transcribed pseudogenes.

--	Display conventions: This track follows the display conventions used by gene prediction tracks.
--	Track details: Clicking on an entry in full display mode will show detailed information about the pseudogene's characteristics, alignment links, and Genome Browser annotation links for the gene locus that spawned the retrogene.
--	Table details: To view a text version of the data set, select the pseudoGeneLink positional table in the Table Browser. To view the table definition, click here.

RGD ESTs
This track shows alignments expressed sequence tags (ESTs) from the Rat Genome Database (RGD).

--	Display conventions: This track uses the display conventions for EST tracks. As with other EST tracks, it may be necessary to zoom in to display entries in full display mode due to the 300 line display limit.
--	Track details: Clicking on an individual EST entry will show basic track information, the accession number, GenBank highlights, links to EST/genomic alignments, and an external link to the RGD EST report.
--	Table details: To view a text version of the data set, select the rgdEst positional table in the Table Browser. To view the table definition, click here.

RGD Genes
This track shows RefSeq genes curated by the Rat Genome Database (RGD).

--	Display conventions: This track follows the display conventions used by gene prediction tracks.
--	Track details: Clicking on an entry in full display mode will display position information, links to sequence displays, and links to outside sources showing additional information.
--	Track configuration: The track description page contains a filter that can be used to turn on codon coloring for the track. Click the "Codon coloring help" link on the page for more information about this feature.
--	Table details: To view a text version of the data set, select the rgdGene positional table in the Table Browser. To view the table definition, click here.

RGD QTL
This track shows quantitative trait loci (QTLs) curated by the Rat Genome Database (RGD).

--	Display conventions: Loci positions are represented by blocks.
--	Track details: Clicking on an entry in full display mode will display genomic information and a link to the corresponding entry in the RGD.
--	Table details: To view a text version of the data set, select the rgdQtl positional table in the Table Browser. To view the table definition, click here.

RGD SSLP
This track shows simple sequence length polymorphisms (SSLPs), also known as microsatellite DNA, from the Rat Genome Database (RGD). SSLPs consist of 1 - 6 simple nucleotide repeat sequences, highly polymorphic in repeat length among strains. They are often used as genetic markers for genotyping.

--	Display conventions: SSLP positions are represented by thin blocks.
--	Track details: Clicking on an entry in full display mode will display genomic information and a link to the corresponding entry in the RGD.
--	Table details: To view a text version of the data set, select the rgdSslp positional table in the Table Browser. To view the table definition, click here.

Rinn Sex Exp
This track shows gene expression differences between adult male and female tissues as described in Rinn, JL et al. (2004) Major Molecular Differences between Mammalian Sexes Are Involved in Drug Metabolism and Renal Function. Developmental Cell 6:791-800.

--	Display conventions: This track follows display conventions similar to mRNA tracks.
--	Track details: In dense or packed display mode, the track shows averages of related tissues. In full display mode, all tissues are displayed. Click on an individual tissue entry to show a gene expression map for all tissues in the experiment.
--	Table details: To view a text version of the data set, select the rinnSex positional table in the Table Browser. To view the table definition, click here.

RNA Genes
This track shows human non-protein-coding RNA genes and RNA pseudogenes. This includes tRNAs, rRNAs, SRPs, methylation guide snoRNAs, U2-U6 RNA-like, and similar elements both known and predicted (by tRNAscanSE etc). The density of these elements can range from 1-4 per million bp in some chromosomes. Protein coding genes are displayed elsewhere in the RefSeq Genes track.

--	Display conventions: RNA genes are represented by light-colored blocks. Pseudogenes are represented by darker blocks.
--	Track details: Clicking on an entry in full display mode will display feature classification, method of prediction, location, reliability score, and a link to DNA sequence for the feature.
--	Table details: To view a text version of the data set, select the rnaGene positional table in the Table Browser. To view the table definition, click here.

Rosetta
This track displays microarray tissue expression data provided by Rosetta Inpharmatics. It helps catalogue genes and transcriptome, complements computational gene predictions, and seeks to define gene boundaries via co-regulated expression of nearby exons.

--	Display conventions: The data is stratified by various tissue and disease-specific conditions of gene expression. Confirmed and predicted exons are placed in separate tracks. Click on the mini-button to the left of the track to display a track description page containing more information.
--	Track configuration: The track description page contains a filter to fine-tune the track display. The following display options are configurable: o Reference Sample: Determines which of the 69 different experiments are displayed, based on the reference sample used. o Exons Shown: Determines whether data is shown for probes corresponding to confirmed, predicted, or all exons. o Color Scheme: Data are presented using two color false display. The default colors can be changed for those who are colorblind. Gray values indicate missing data.
--	Track details: Clicking on a Rosetta exon in full display mode will show an averaged display that can be expanded via checkboxes to a graph of actual intensities for an individual experiment.
--	Table details: To view a text version of the data set, select the rosetta positional table in the Table Browser. To view the table definition, click here.

Sanger 22 and Sanger 22 Pseudo
These tracks contain the Sanger Centre annotations of chromosome 22.

--	Display conventions: This track uses the display conventions for gene predictions tracks.
--	Track details: Clicking on the track while in full display mode will show details of the methods used to construct this track as well as the contributors.
--	Table details: To view a text version of the data set, select the sanger22 positional table in the Table Browser. To view the table definition, click here.

S. cerevisiae ESTs
See the Human ESTs track description.

S. cerevisiae mRNAs
See the Human mRNAs track description.

Scaffolds (Chimp)
This track shows the chromosome-based version of the November 2003 Arachne chimp assembly (panTro1) from the Chimp Genome Sequencing Consortium.

--	Display conventions: In dense display mode, this track depicts in alternating gold and brown the individual scaffolds used to create the assembled sequence. Where gaps exist in the path, spaces are shown between the gold and brown blocks. Relative order and orientation of the scaffolds, as determined from the human/chimp alignments, is implied for the non-random chromosomes. The display must be sufficiently zoomed in to view the gap features.
--	Track details: Clicking on an item in full display mode will show information about the scaffold fragment and bases and position information.
--	Table details: To view a text version of the data set, select the gold positional table in the Chimp Table Browser. To view the table definition, click here.

Scaffolds (Fugu, Zebrafish, Tetraodon)
This track shows the draft and finished clones that comprise the assembly.

--	Display conventions: In dense display mode, this track depicts in alternating gold and brown the individual clones used to create the assembled sequence. Where gaps exist in the path, spaces are shown between the gold and brown blocks. If the relative order and orientation of the contigs between the two blocks is known, a line is drawn to bridge the blocks. The display must be sufficiently zoomed in to view the gap features.
--	Track details: Clicking on an item in full display mode will show contig and position information.
--	Table details: To view a text version of the data set, select the gold positional table in the Fugu or Zebrafish Table Browser. To view the table definition, click here.

Segmental Duplications
This track shows regions detected as putative genomic duplications within the golden path. For a description of the 'fuguization' detection method, see Bailey JA et. al. (2001). "Segmental duplications: organization and impact within the current human genome project assembly". Genome Res 11:1005-17.

--	Display conventions: Orange, yellow, dark-light gray represent similarities of greater than 99%, 99-98% and 98-90% respectively. Duplications greater than 98% similarity that lack sufficient SDD evidence (likely missed overlaps) are shown as red. Cut off values were at least 1 kb of total sequence aligned (containing at least 500 bp non-RepeatMasked sequence) and at least 90% sequence identity.
--	Track details: Clicking on an entry in full display mode provides position, filter, and alignment information as well as links to the corresponding genomic sequence.
--	Table details: To view a text version of the data set, select the genomicSuperDups positional table in the Table Browser. To view the table definition, click here.

Self Chain
This track shows alignments of the selected genome with itself using blastz and axtChain.

--	Display conventions: This track uses the display conventions for chain tracks.
--	Track details: Clicking on an item in full display mode shows position information, the chain ID and score, and provides links to view details of parts of the chain or to open the browser to the corresponding aligning position.
--	Table details: To view a text version of the data set, select the chainSelf positional table in the Table Browser. To view the table definition, click here.

SGD Genes
This track shows annotated genes and open reading frames (ORFs) of Saccharomyces cerevisiae obtained from the Saccharomyces Genome Database (SGD).

--	Display conventions: This track uses the display conventions for known genes and gene predictions tracks.
--	Track details: Clicking on an entry in full display mode provides a wealth of genomic, mRNA, and protein information about the gene as well as links to several associated external sites.
--	Table details: To view a text version of the data set, select the sgdGene positional table in the Table Browser. To view the table definition, click here.

SGD Other
This track shows a variety of features in the Saccharomyces cerevisiae genome, including tRNAs, transposons, centromeres, and open reading frames (ORFs) classified as dubious. The data was downloaded from the Saccharomyces Genome Database (SGD).

--	Display conventions: This track uses the display conventions for known genes and gene predictions tracks.
--	Track details: Clicking on an entry in full display mode provides genomic information and a link to view the DNA underlying the track.
--	Table details: To view a text version of the data set, select the sgdOther positional table in the Table Browser. To view the table definition, click here.

SGP Genes
This track shows gene predictions from the SGP program, which is being developed at the Grup de Recerca en Informàtica Biomèdica (GRIB) at Institut Municipal d'Investigació Mèdica (IMIM) in Barcelona. To predict genes in a genomic query, SGP combines geneid predictions with tblastx comparisons of the genomic query against other genomic sequences.

--	Display conventions: This track uses the display conventions for known genes and gene predictions tracks.
--	Track details: Clicking on an entry in full display mode provides position information as well as links to the corresponding protein, mRNA, genomic, and comparative sequences.
--	Table details: To view a text version of the data set, select the sgpGene positional table in the Table Browser. To view the table definition, click here.

Short Match
This track shows all occurrences of a selected short motif within the displayed position range of the assembly sequence. It is useful for finding oligonucleotides, restriction sites, or other recurring short sequences within the assembly.

--	Display conventions: Perfect matches are indicated by a solid rectangle. In full display mode, each occurrence is labeled by the strand on which the match is located, followed by the starting coordinate of the match. In cases where the input motif sequence is identical to its reverse complement, only the match on the "+" strand is shown.
--	Track details: Clicking on an entry in full display mode provides position information about the match.
--	Track configuration: The track may be configured to search for any short sequence of 2-30 bases in length. To change the sequence, type a new sequence into the text box at the top of the track description page.
--	Table details: Unlike most annotations in the Genome Browser, this track is not table-based.

Simple Repeats
This track displays simple tandem repeats (possibly imperfect) located by Tandem Repeats Finder, which is specialized to this purpose. These repeats can occur within coding regions of genes and may be quite polymorphic. Repeat expansions are sometimes associated with specific diseases.

--	Display conventions: Repeats are represented by block boxes that indicate location in the assembly.
--	Track details: Clicking on an item in full display mode will show the simple repeat sequence, copy number, and quality of match statistics.
--	Table details: To view a text version of the data set, select the simpleRepeats positional table in the Table Browser. To view the table definition, click here.

Slam Human, Slam Mouse, Slam Rat
These tracks predict coding exons and conserved noncoding regions in a pair of homologous DNA sequences, incorporating both statistical sequence properties and the degree of conservation in making the predictions. The model is symmetric: the same gene structure (with possibly different exon lengths) is predicted in both sequences.

--	Display conventions: This track uses the display conventions for gene predictions tracks.
--	Track details: Clicking on an entry in full display mode will show basic track information, plus links to the predicted mRNA, genomic sequence, and comparative sequence.
--	Table details: To view a text version of the data set, select the appropriate slam positional table in the Table Browser (e.g. slamHuman, slamMouse, slamRat). To view the table definition, click here.

SlamHumanNonCoding, SlamMouseNonCoding, SlamRatNonCoding
These tables show slam predictions of conserved noncoding regions in homologous DNA sequences.

--	Display conventions: The data in these tables are displayed as part of the Slam Human, Slam Mouse, and Slam Rat tracks. See the track descriptions for these tracks for display information.
--	Table details: To view a text version of the data set, select the appropriate slamNonCoding positional table in the Table Browser (e.g. slamHumanNonCoding, slamMouseNonCoding, slamRatNonCoding). To view the table definition, click here.

SNAP Genes (C. intestinalis)
This track shows gene predictions determined by SNAP (Semi-HMM-based Nucleic Acid Parser), a general purpose gene-finding program written by Ian Korf. SNAP is suitable for both eukaryotic and prokaryotic genomes. For this set of gene predictions, it was trained on gene annotations from the DOE Joint Genome Institute (JGI).

--	Display conventions: This track uses the display conventions for gene predictions tracks.
--	Track details: Clicking on an entry in full display mode brings up basic track information, plus links to the translated protein, predicted mRNA, and genomic sequences.
--	Table details: To view a text version of the data set, select the snapGene positional table in the Table Browser. To view the table definition, click here.

Sno/miRNA
This track displays positions of four different types of RNA in the human genome: microRNAs from the miRNA Registry at the Wellcome Trust Sanger Institute, small nucleolar RNAs (C/D box and H/ACA box snoRNAs) and Cajal body-specific RNAs (scaRNAs) from the snoRNA-LBME-DB maintained at the Laboratoire de Biologie Moléculaire Eucaryote. C/D box and H/ACA box snoRNAs are guides for the 2'O-ribose methylation and the pseudouridilation, respectively, of rRNAs and snRNAs, although many of them have no documented target RNA. The scaRNAs guide modifications of the spliceosomal snRNAs transcribed by RNA polymerase II, and often contain both C/D and H/ACA domains.

--	Display conventions: Mature miRNAs (miRs) are represented by thick red blocks; the predicted stem-loop portions of the primary transcripts are indicated by thinner blocks. When a single precursor produces two mature miRs from its 5' and 3' parts, both positions of the mature miRNA are individually displayed. C/D box, H/ACA box snoRNAs and scaRNAs are represented by blue, green and magenta blocks, respectively. At a zoomed-in resolution, arrows superimposed on the blocks indicate the sense orientation of the snoRNAs.
--	Track details: Clicking on an entry in full display mode provides a link to the miRNA Registry, the RNA type, position information, and a link to the DNA sequence associated with the feature.
--	Table details: To view a text version of the data set, select the wgRna positional table in the Table Browser. To view the table definition, click here.

SNPs (Human assemblies hg17 and later)
This track displays all the known Simple Nucleotide Polymorphisms (SNPs) that can be mapped against the current genome assembly. These data were obtained from dbSNP and commercially-available genotyping arrays and include known point mutations (Single Nucleotide Polymorphisms), insertions, deletions, multiple See the track description page for more information about the SNP classifications. These data were provided by the SNP Consortium and Affymetric, Inc..

--	Display conventions: Variants are drawn a single tick marks at most zoom levels. When viewing the track at or near base-level resolution, the displayed width of the SNP corresponds to the width of the variant in the reference sequence. Insertions are indicated by a single tick mark displayed between two nucleotides, single nucleotide polymorphisms are displayed as the width of a single base, and multiple nucleotide variants are represented by a block that spans two or more bases.
--	Track details: Clicking in full mode brings up position information about the reference sequence, detailed information about the variant, and a link to the record in dbSNP.
--	Track configuration: The colors of variants may be changed to highlight their source, molecule type, variant class, validation status, or functional classification. Variants can be excluded from the display based on these same criteria or if they fall below the user-specified minimum average heterozygosity.
--	Table details: To view a text version of the data set, select the snp positional table in the Table Browser. To view the table definition, click here.

SNPs (Human assemblies prior to hg17)
This track displays all the known Simple Nucleotide Polymorphisms (SNPs) that can be mapped against the current genome assembly. These include known point mutations (Single Nucleotide Polymorphisms), insertions, deletions, and segmental mutations from the current build of dbSnp (shown in the Genome Browser release log). See the track description page for more information about major cases that are not mapped. These data were provided by the SNP Consortium.

--	Display conventions: SNP locations are indicated by thin grey vertical lines.
--	Track details: Clicking in full mode brings up a location description and dbSNP link.
--	Table details: To view a text version of the data set, select the snpMap positional table in the Table Browser. To view the table definition, click here.

Spliced ESTs
The Spliced EST track displays the subset of Expressed Sequence Tags (ESTs) from GenBank that show signs of splicing when aligned against the genome. ESTs are single read (typically approximately 500 base) sequences that usually represent fragments of transcribed genes. By requiring splicing, the level of contamination in the EST databases is drastically reduced at the expense of eliminating many genuine 3' ESTs. This track may also suggest alternate splices. The GT-AG splice donor/acceptor rule has not been applied. For a display of all ESTs (including unspliced), see the Human EST track. This track was generated by aligning human ESTs from GenBank against the genome using the BLAT program. Note that the maximum intron length allowed by BLAT is 500,000 bases, which may eliminate some ESTs with very long introns that might otherwise align. When a single EST aligns in multiple places, the alignment having the highest base identity is found. Only alignments that have a base identity level within 1% of the best are kept. Alignments must also have at least 93% base identity to be kept.

--	Display conventions: This track uses the display conventions for EST tracks As with other EST tracks, it may be necessary to zoom in to display entries in full display mode due to the 300 line display limit.
--	Track details: Clicking on an individual EST entry will show basic track information, the accession number, GenBank highlights, and links to translated protein, predicted mRNA, and genomic sequences.
--	Table details: To view a text version of the data set, select the intronEst positional table in the Table Browser. To view the table definition, click here.

STS Markers (human)
This track shows the locations of Sequence Tagged Site (STS) markers along the draft assembly. The STS markers have been mapped using either genetic (Genethon and Marshfield maps), radiation hybridization (the Stanford, Whitehead RH, and GeneMap99 maps) or YAC mapping (the Whitehead YAC map) techniques. In releases prior to August 2001, this track also shows the approximate position of FISH mapped clones. Starting with the August 2001 assembly, the FISH clones have been moved into a separate track.

--	Display conventions: Genetic map markers are shown in blue, and radiation hybrid map markers are shown in black. When a marker maps to multiple positions in the genome, it is shown in a lighter color.
--	Track details: Clicking on a specific marker in full display mode will show synonyms, position information, primers, YAC map position, and uniSTS and GDB links.
--	Table details: To view a text version of the data set, select the stsMap positional table in the Table Browser. To view the table definition, click here.

STS Markers (mouse)
This track shows the locations of Sequence Tagged Site (STS) markers along the draft assembly of the mouse genome. These STS markers appear on the MGI consensus mouse genetic map. Information about the genetic map and STS marker primer sequences are provided by the Mouse Genome Informatics database group at The Jackson Laboratory.

--	Display conventions: Genetic map markers are shown as thin black boxes.
--	Track details: Clicking on a specific marker in full display mode will show position information, primers, genetic map position, genomic alignments, and MGI links.
--	Table details: To view a text version of the data set, select the stsMapMouse positional table in the Table Browser. To view the table definition, click here.

STS Markers (rat)
This track shows locations of Sequence Tagged Site (STS) markers along the draft assembly of the rat genome. These STSs have been mapped using either genetic (rat FHH x ACI F2 intercross genetic map, rat SHRSP x BN F2 intercross genetic map) or radiation hybridization (RH map.2.2).

--	Display conventions: Genetic map markers are shown as thin black boxes.
--	Track details: Clicking on a specific marker in full display mode will show position information, primers, genetic map position, and links to the corresponding UniSTS and RGD entries.
--	Table details: To view a text version of the data set, select the stsMapRat positional table in the Table Browser. To view the table definition, click here.

Superfamily
The Superfamily track shows proteins having homologs with known structures or functions. Each entry in the track shows the coding region of a gene (based on Ensembl gene prediction). The label, shown in Full mode at the left hand side of each entry, consists of the names of all known protein domains coded by this gene. This usually contains structural and/or function descriptions that provide valuable information for getting a quick grasp of the biological significance for the gene.

--	Display conventions: Coding regions are indicated by red blocks.
--	Track details: Clicking on an entry in full display mode will show the Superfamily domains of the corresponding protein and provide a link to the Superfamily database entry.
--	Table details: To view a text version of the data set, select the superfamily positional table in the Table Browser. To view the table definition, click here.

Tetraodon Chain
This track shows Tetraodon genomic alignments to the selected genome using blastz and axtChain. See the Human Chain track description for more information.

Tetraodon Ecores
This track shows Tetraodon evolutionary conserved regions (ecores) computed against the selected assembly genome by the Exofish program at Genoscope. For information on this track, see the Human Ecores track description.

Tetraodon Net
This track shows the best Tetraodon chain for every part of the selected genome. See the Human Net track description for more information.

TFBS Conserved
This tracks shows the location and score of transcription factor binding sites (TFBSs) conserved in a multiple species alignment. A binding site is considered to be conserved across the alignment if its score meets the threshold score for that binding site in all aligned species. The score and threshold are computed with the Transfac Matrix Database created by Biobase. The data are purely computational, and as such not all binding sites listed here are biologically functional binding sites.

--	Display conventions: TFBSs are represented by thin blocks. The darker the shading, the better the match of the binding site.
--	Track details: Clicking on a block in full display mode will show the the entry's Transfac ID, positional information, and a link to its Transfac Matrix (free registration with Transfac is required).
--	Table details: To view a text version of the data set, select the tfbsCons positional table in the Table Browser. To view the table definition, click here.

Tight Mouse
This track displays Blastz alignments of the specified mouse draft assembly to the human genome, filtered by axtBest and subsetAxt with very stringent constraints. See the track's description page for more details.

--	Display conventions: This track uses the display conventions for cross-species synteny tracks.
--	Track details: Clicking on an entry in full display mode will show human and mouse position information, alignment details, and a link to a detailed view of parts of the alignment.
--	Track configuration: The track description page contains a filter that can be used to turn on the chromosome color track or to filter the display output by chromosome.
--	Table details: To view a text version of the data set, select the blastzTightMouse positional table in the Table Browser. To view the table definition, click here.

Tight Rat
This track displays Blastz alignments of the Nov. 2002 rat draft assembly to the mouse genome, filtered by axtBest and subsetAxt with very stringent constraints. See the track's description page for more details.

--	Display conventions: This track uses the display conventions for cross-species synteny tracks.
--	Track details: Clicking on an entry in full display mode will show mouse and rat position information, alignment details, and a link to a detailed view of parts of the alignment.
--	Track configuration: The track description page contains a filter that can be used to turn on the chromosome color track or to filter the display output by chromosome.
--	Table details: To view a text version of the data set, select the blastzTightRat positional table in the Table Browser. To view the table definition, click here.

Tigr Gene Index
This track displays alignments of the TIGR Gene Index (TGI) against the human genome. The TGI is based largely on assemblies of EST sequences from the public databases and TIGR. Entries are actual assemblies providing a consensus sequence, not simply clusters of overlapping sequences, but generally don't predict whole genes. Gene indices for mouse, rat, cow, and pig also contribute to this track.

--	Display conventions: This track uses the display conventions for gene predictions tracks.
--	Track details: Clicking on an entry in full display mode will show basic track information, links to the predicted mRNA and genomic sequences, and a link to supporting information in the TIGR Human Gene Index.
--	Table details: To view a text version of the data set, select the tigrGeneIndex positional table in the Table Browser. To view the table definition, click here.

Transcriptome
This track shows transcriptome data for chromosomes 21 and 22 from Affymetrix, as described in "Large-Scale Transcriptional Activity in Chromosomes 21 and 22", Kapranov, P., Cawley, S. E., Drenkow, J., Bekiranov, S, Strausberg, R. L., Fodor, S.P.A. and Gingeras, T.R.. In general, the data presented is the perfect match - mismatch value. Different experiments were normalized by setting the average value to be the same for each chip.

--	Display conventions: This track uses the display conventions for wiggle tracks. To present a more interpretable display when zoomed out, averages have been precalculated over the chromosome at two different resolutions in addition to the raw data. For example, when zoomed out, there may appear to be a peak at the center of a gene rather than a signal at every exon. Zooming in will reveal the raw data for that region.
--	Track details: In dense mode (or at the top of the track in full mode), the transcriptome wiggle track displays the maximum value over all experiments for that probe, the idea being to paint as many transcribed regions as possible. In full mode, the track displays a separate wiggle track for each cell type, showing the data produced by averaging together replicates for that cell type. Clicking on an individual data point will show positional information and a link to view the sequence for the feature.
--	Table details: To view a text version of the data set, select the affyTranscriptome positional table in the Table Browser. To view the table definition, click here.

Twinscan Gene Predictions
This track displays Twinscan gene predictions. Twinscan predicts genes in a manner similar to Genscan, except that Twinscan takes advantage of genome comparison to improve gene prediction accuracy. More information and a web server can be found at the Washington University St. Louis Twinscan web page.

--	Display conventions: This track uses the display conventions for gene predictions tracks.
--	Track details: Clicking on an entry in full display mode will show basic track information, links to the predicted protein, predicted mRNA, genomic sequence, and comparative sequence.
--	Table details: To view a text version of the data set, select the twinscan positional table in the Table Browser. To view the table definition, click here.

UCSC Synteny (hg12)
See description for Mouse Synteny (hg13+).

UniGene
This track shows UniGene clusters of ESTs aligned to the genome using BLAT. This data imperfectly indicates exon/intron boundaries and to a lesser extent genes. The Serial Analysis of Gene Expression (SAGE) project at NCBI - a quantitative measurement of gene expression in various tissues and disease states - mapped small 10bp bar-coded expression markers onto these UniGene clusters in the SageMap project. The Genome Browser uses this mapping to provide access to the SAGE data associated with the UniGene track in the assembled and annotated genome.

--	Display conventions: This track uses the display conventions for mRNA tracks.
--	Track details: Clicking on a UniGene feature will show an elaborate display of tabular and graphical data from the SAGE project relevant to that cluster.
--	Table details: To view a text version of the data set, select the uniGene positional table in the Table Browser. To view the table definition, click here.

Vega Genes (selected human chromosomes only)
This track shows genes from the Vertebrate Genome Annotation (VEGA) database, a central repository for manual annotation of different vertebrate finished genome sequence. In collaboration with the genome sequencing centers, Vega attempts to present consistent high-quality curation of the published chromosome sequences. Finished genomic sequence is analysed on a clone by clone basis using a combination of similarity searches against DNA and protein databases as well as a series of ab initio gene predictions (GENSCAN, Fgenes). In addition, comparative analysis using vertebrate datasets such as the Riken mouse cDNAs and Genoscope Tetraodon nigroviridis Ecores (Evolutionary Conserved Regions) are used for novel gene discovery.

--	Display conventions: This track uses the display conventions for gene prediction tracks.
--	Track details: Clicking on an entry in full display mode will show basic track information, a link to the Vega web page for the item, and links to the predicted protein, predicted mRNA, genomic sequence, and comparative sequence.
--	Table details: To view a text version of the data set, select the vegaGene positional table in the Table Browser. To view the table definition, click here.

Vega Pseudogenes (selected human chromosomes only)
This track shows annotated pseudogenes and immunoglobulin segments from the Vertebrate Genome Annotation (VEGA) database, a central repository for manual annotation of different vertebrate finished genome sequence. In collaboration with the genome sequencing centers, Vega attempts to present consistent high-quality curation of the published chromosome sequences. Finished genomic sequence is analysed on a clone by clone basis using a combination of similarity searches against DNA and protein databases as well as a series of ab initio gene predictions (GENSCAN, Fgenes). In addition, comparative analysis using vertebrate datasets such as the Riken mouse cDNAs and Genoscope Tetraodon nigroviridis Ecores (Evolutionary Conserved Regions) are used for novel gene discovery.

--	Display conventions: This track uses the display conventions for gene prediction tracks.
--	Track details: Clicking on an entry in full display mode will show basic track information, a link to the Vega web page for the item, and links to the predicted mRNA, genomic sequence, and comparative sequence.
--	Table details: To view a text version of the data set, select the vegaPseudoGene positional table in the Table Browser. To view the table definition, click here.

WashU Clones
This track displays the location of clones (mostly lambda and cosmid clones) from Washington University in St. Louis using the names assigned by that group. The data was downloaded from the Saccharomyces Genome Database (SGD).

--	Display conventions: The clone positions are shown in black.
--	Track details: Clicking on an entry in full display mode brings up genomic information and a link to the American Type Culture Collection (ATCC) website.
--	Table details: To view a text version of the data set, select the sgdClone positional table in the Table Browser. To view the table definition, click here.

WormBase Genes
This track shows Sanger Gene predictions from the Wormbase files downloaded from the Sanger Institute FTP site. The data shown is the subset annotated with "curated", "DNA", or "RNA" followed by one of these strings: "intron", "exon", "cds", "sequence", or "transcri".

--	Display conventions: This track uses the display conventions for gene prediction tracks.
--	Track details: Clicking on an entry in full display mode will show a wealth of information about the gene and its associated mRNA and protein, as well as links to many related external sites.
--	Track configuration: The track description page contains a filter that can be used to turn on codon coloring for the track. Click the "Codon coloring help" link on the page for more information about this feature.
--	Table details: To view a text version of the data set, select the sangerGene positional table in the Table Browser. To view the table definition, click here.

WormBase Genefinder
This track shows Sanger Gene predictions from the Wormbase files downloaded from the Sanger Institute FTP site. The data shown is the subset annotated with the string "Genefinder" and found by the gene prediction program, Genefinder.

--	Display conventions: This track uses the display conventions for gene prediction tracks.
--	Track details: Clicking on an entry in full display mode will show genomic information and links to the translated protein, predicted mRNA, genomic sequence.
--	Track configuration: The track description page contains a filter that can be used to turn on codon coloring for the track. Click the "Codon coloring help" link on the page for more information about this feature.
--	Table details: To view a text version of the data set, select the sangerGenefinder positional table in the Table Browser. To view the table definition, click here.

WSSD Coverage
This track represents coverage of clones that were assayed for segmental duplications using high-depth Celera reads. Absent regions were not assessed by this version of the Segmental Duplication Database (SDD). For a description of the whole-genome shotgun sequence detection (WSSD) "fuguization" method, see Bailey, JA. et al., Segmental duplications: organization and impact within the current human genome project assembly, Genome Res. 11(6), 1005-17 (2001).

--	Display conventions: Rectangular blocks indicate the positions of clones.
--	Track details: Clicking on an entry in full display mode will show position information and a link to the underlying DNA for the feature.
--	Table details: To view a text version of the data set, select the celeraCoverage positional table in the Table Browser. To view the table definition, click here.

WSSD Duplication
High-depth sequence reads from the Celera project were used to detect paralogy in the human genome reference sequence. This track shows confirmed segmental duplications, defined as having similarity to sequences in the Segmental Duplication Database (SDD) of greater than 90% over more than 250 bp of repeatmasked sequence. For a description of the whole-genome shotgun sequence detection (WSSD) 'fuguization' method, see Bailey, JA. et al., Segmental duplications: organization and impact within the current human genome project assembly, Genome Res. 11(6), 1005-17 (2001).

--	Display conventions: Rectangular blocks indicate the positions of duplications.
--	Track details: Clicking on an entry in full display mode will show the WSSD ID number, position information, and a link to the underlying DNA for the feature.
--	Table details: To view a text version of the data set, select the celeraDupPositive positional table in the Table Browser. To view the table definition, click here.

WSSD Overlay
This track shows regions detected as overlays of Celera whole-genome shotgun sequence assembly on the public human assembly.

--	Display conventions: Regions are represented by rectangular blocks.
--	Track details: Clicking on an entry in full display mode will show position information and a link to the underlying DNA for the feature.
--	Table details: To view a text version of the data set, select the celeraOverlay positional table in the Table Browser. To view the table definition, click here.

X. tropicalis Chain
This track shows X. tropicalis genomic alignments to the selected genome using blastz and axtChain. See the Human Chain track description for more information.

X. tropicalis ESTs
See the description for the Human ESTs track.

X. tropicalis mRNAs
See the description for the Human mRNAs track.

X. tropicalis Net
This track shows the best X. tropicalis chain for every part of the selected genome. See the Human Net track description for more information.

Yale Pseudo
This track shows pseudogenes identified in the Yale Pseudogene Database.

--	Display conventions: This track uses the display conventions for gene prediction tracks.
--	Track details: Clicking on an entry in full display mode will show genomic information, a link to the corresponding pseudogene entry in the Yale Pseudogene Database, and links to predicted mRNA and genomic sequence.
--	Track configuration: The track description page provides an option to turn on codon coloring for the track. Click the "Codon coloring help" link on the page for more information about this feature.
--	Table details: To view a text version of the data set, select the pseudoYale positional table in the Table Browser. To view the table definition, click here.

Zebrafish Chain
This track shows zebrafish genomic alignments to the selected genome using blastz and axtChain. See the Human Chain track description for more information.

Zebrafish ESTs
See the Human ESTs track description.

Zebrafish mRNAs
See the Human mRNAs track description.

Zebrafish Net
This track shows the best Zebrafish chain for every part of the selected genome. See the Human Net track description for more information.

Zfish WZ EST Clusters
(Zebrafish) This track shows alignments between zebrafish WZ expressed sequence tags (ESTs) from WashU-Zebrafish Genome Resources and the genome. These WZ ESTs are compiled to produce longer reads by clustering together ESTs that originate from the same transcript.

--	Display conventions: This track uses the display conventions for EST tracks. Hatch marks on the introns indicate the direction of transcription. As with otherEST tracks, it may be necessary to zoom in to display entries in full display mode due to the 300 line display limit.
--	Track details: Clicking on an individual EST entry displays a link to the genomic alignment.
--	Table details: To view a text version of the data set, select the wz_ests positional table in the Table Browser. To view the table definition, click here.

ZGC Genes (Zebrafish)
This track shows alignments to the genome of zebrafish mRNAs from the Mammalian Gene Collection (MGC) having full-length open reading frames (ORFs).

--	Display conventions: This track uses the display conventions for known genes and gene predictions tracks.
--	Track details: Clicking on an entry in full display provides links to the corresponding protein, mRNA, and genomic sequences, and related links to outside databases.
--	Track configuration: The track description page offers configuration options that can be used to turn on codon coloring for the track. Click the "Codon coloring help" link on the page for more information about this feature.
--	Table details: To view a text version of the data set, select the mgcGenes positional table in the Table Browser. To view the table definition, click here.

ZooSeq (Zoo)
This track displays the level of conservation for each zoo species based on blastz pair-wise alignments.

--	Display conventions: This track uses the display conventions for wiggle tracks. Gray horizontal bars denote a mapping/sequencing gap. Percent identities of less than 50% are not shown because they fall below the minimum y-axis value.
--	Track configuration: The track description page contains options to configure several of the graph characteristics. To read more information about each option, click the "Graph configuration help" link.
--	Track details: Clicking on an entry in full display mode will show basic track information, a link to the Vega web page for the item, and links to the predicted mRNA, genomic sequence, and comparative sequence.
--	Table details: To view a text version of the data set, select the zoo positional table in the Table Browser. To view the table definition, click here.